Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335449717:

Variant ID: vg0335449717 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 35449717
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.87, A: 0.12, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

AGGCGCGGTCAAACTTGGCATAGTCTTCAAGACAAATCTTTGACTTTAAATTTCTCATATACTATAATGTTTGTAACAACAAAATCATAATCATATGAAA[G/A]
TAAATTTAAATGATAGTCCAATTATTACTTTAATCAAATAAACTTTAATTTATAATAAACTATTTATTGGTCAAATATTTAAAGATTTGAATCTTAAAAT

Reverse complement sequence

ATTTTAAGATTCAAATCTTTAAATATTTGACCAATAAATAGTTTATTATAAATTAAAGTTTATTTGATTAAAGTAATAATTGGACTATCATTTAAATTTA[C/T]
TTTCATATGATTATGATTTTGTTGTTACAAACATTATAGTATATGAGAAATTTAAAGTCAAAGATTTGTCTTGAAGACTATGCCAAGTTTGACCGCGCCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.50%	24.40%	0.06%	0.04%	NA
All Indica	2759	64.60%	35.20%	0.11%	0.07%	NA
All Japonica	1512	98.70%	1.30%	0.00%	0.00%	NA
Aus	269	49.80%	50.20%	0.00%	0.00%	NA
Indica I	595	86.20%	13.80%	0.00%	0.00%	NA
Indica II	465	84.10%	15.70%	0.22%	0.00%	NA
Indica III	913	45.00%	54.90%	0.11%	0.00%	NA
Indica Intermediate	786	59.40%	40.20%	0.13%	0.25%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	96.40%	3.60%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	77.80%	22.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0335449717	G -> A	LOC_Os03g62650.1	upstream_gene_variant ; 3706.0bp to feature; MODIFIER	silent_mutation	Average:48.118; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N
vg0335449717	G -> A	LOC_Os03g62650.2	upstream_gene_variant ; 3706.0bp to feature; MODIFIER	silent_mutation	Average:48.118; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N
vg0335449717	G -> A	LOC_Os03g62650.3	upstream_gene_variant ; 3706.0bp to feature; MODIFIER	silent_mutation	Average:48.118; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N
vg0335449717	G -> A	LOC_Os03g62630.1	downstream_gene_variant ; 3354.0bp to feature; MODIFIER	silent_mutation	Average:48.118; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N
vg0335449717	G -> A	LOC_Os03g62640.2	intron_variant ; MODIFIER	silent_mutation	Average:48.118; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N
vg0335449717	G -> A	LOC_Os03g62640.3	intron_variant ; MODIFIER	silent_mutation	Average:48.118; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N
vg0335449717	G -> A	LOC_Os03g62640.4	intron_variant ; MODIFIER	silent_mutation	Average:48.118; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N
vg0335449717	G -> A	LOC_Os03g62640.5	intron_variant ; MODIFIER	silent_mutation	Average:48.118; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N
vg0335449717	G -> DEL	N	N	silent_mutation	Average:48.118; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0335449717	NA	3.06E-06	mr1043	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717	NA	3.91E-12	mr1065	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717	NA	1.24E-08	mr1068	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717	NA	3.36E-06	mr1086	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717	NA	3.62E-14	mr1091	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717	NA	6.73E-11	mr1094	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717	NA	6.72E-09	mr1096	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717	NA	1.38E-07	mr1104	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717	NA	7.88E-07	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717	NA	5.30E-10	mr1108	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717	NA	4.53E-09	mr1110	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717	NA	1.87E-06	mr1111	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717	NA	3.01E-10	mr1112	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717	NA	4.83E-10	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717	NA	7.58E-07	mr1144	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717	NA	2.21E-09	mr1213	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717	NA	2.42E-12	mr1234	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717	NA	3.60E-08	mr1237	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717	NA	3.04E-07	mr1246	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717	NA	1.13E-12	mr1063_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717	NA	2.46E-11	mr1065_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717	NA	1.93E-12	mr1091_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717	NA	1.38E-08	mr1094_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717	NA	1.22E-07	mr1096_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717	NA	5.36E-09	mr1112_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717	NA	3.30E-09	mr1161_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717	NA	2.17E-08	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717	NA	7.36E-06	mr1215_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717	NA	6.72E-09	mr1218_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717	NA	3.37E-12	mr1221_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717	NA	7.22E-07	mr1242_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717	NA	1.34E-08	mr1260_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717	NA	4.65E-11	mr1378_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717	NA	5.12E-07	mr1378_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717	NA	5.19E-08	mr1422_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717	NA	2.43E-07	mr1568_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717	NA	1.06E-06	mr1870_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251