\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335449717:

Variant ID: vg0335449717 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 35449717
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.87, A: 0.12, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


AGGCGCGGTCAAACTTGGCATAGTCTTCAAGACAAATCTTTGACTTTAAATTTCTCATATACTATAATGTTTGTAACAACAAAATCATAATCATATGAAA[G/A]
TAAATTTAAATGATAGTCCAATTATTACTTTAATCAAATAAACTTTAATTTATAATAAACTATTTATTGGTCAAATATTTAAAGATTTGAATCTTAAAAT

Reverse complement sequence

ATTTTAAGATTCAAATCTTTAAATATTTGACCAATAAATAGTTTATTATAAATTAAAGTTTATTTGATTAAAGTAATAATTGGACTATCATTTAAATTTA[C/T]
TTTCATATGATTATGATTTTGTTGTTACAAACATTATAGTATATGAGAAATTTAAAGTCAAAGATTTGTCTTGAAGACTATGCCAAGTTTGACCGCGCCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.50% 24.40% 0.06% 0.04% NA
All Indica  2759 64.60% 35.20% 0.11% 0.07% NA
All Japonica  1512 98.70% 1.30% 0.00% 0.00% NA
Aus  269 49.80% 50.20% 0.00% 0.00% NA
Indica I  595 86.20% 13.80% 0.00% 0.00% NA
Indica II  465 84.10% 15.70% 0.22% 0.00% NA
Indica III  913 45.00% 54.90% 0.11% 0.00% NA
Indica Intermediate  786 59.40% 40.20% 0.13% 0.25% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 96.40% 3.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0335449717 G -> A LOC_Os03g62650.1 upstream_gene_variant ; 3706.0bp to feature; MODIFIER silent_mutation Average:48.118; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N
vg0335449717 G -> A LOC_Os03g62650.2 upstream_gene_variant ; 3706.0bp to feature; MODIFIER silent_mutation Average:48.118; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N
vg0335449717 G -> A LOC_Os03g62650.3 upstream_gene_variant ; 3706.0bp to feature; MODIFIER silent_mutation Average:48.118; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N
vg0335449717 G -> A LOC_Os03g62630.1 downstream_gene_variant ; 3354.0bp to feature; MODIFIER silent_mutation Average:48.118; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N
vg0335449717 G -> A LOC_Os03g62640.2 intron_variant ; MODIFIER silent_mutation Average:48.118; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N
vg0335449717 G -> A LOC_Os03g62640.3 intron_variant ; MODIFIER silent_mutation Average:48.118; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N
vg0335449717 G -> A LOC_Os03g62640.4 intron_variant ; MODIFIER silent_mutation Average:48.118; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N
vg0335449717 G -> A LOC_Os03g62640.5 intron_variant ; MODIFIER silent_mutation Average:48.118; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N
vg0335449717 G -> DEL N N silent_mutation Average:48.118; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0335449717 NA 3.06E-06 mr1043 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717 NA 3.91E-12 mr1065 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717 NA 1.24E-08 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717 NA 3.36E-06 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717 NA 3.62E-14 mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717 NA 6.73E-11 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717 NA 6.72E-09 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717 NA 1.38E-07 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717 NA 7.88E-07 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717 NA 5.30E-10 mr1108 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717 NA 4.53E-09 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717 NA 1.87E-06 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717 NA 3.01E-10 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717 NA 4.83E-10 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717 NA 7.58E-07 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717 NA 2.21E-09 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717 NA 2.42E-12 mr1234 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717 NA 3.60E-08 mr1237 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717 NA 3.04E-07 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717 NA 1.13E-12 mr1063_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717 NA 2.46E-11 mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717 NA 1.93E-12 mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717 NA 1.38E-08 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717 NA 1.22E-07 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717 NA 5.36E-09 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717 NA 3.30E-09 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717 NA 2.17E-08 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717 NA 7.36E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717 NA 6.72E-09 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717 NA 3.37E-12 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717 NA 7.22E-07 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717 NA 1.34E-08 mr1260_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717 NA 4.65E-11 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717 NA 5.12E-07 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717 NA 5.19E-08 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717 NA 2.43E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335449717 NA 1.06E-06 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251