\
| Variant ID: vg0335411667 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr03 | Position: 35411667 |
| Reference Allele: A | Alternative Allele: C,AAAC,AAC,AC,AAAAC |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TCTATATCAAAATTACTCCTTTATCAGCAAAGAGCCTCATGTGGTGTCTTGGACATATCATGAAAAATGTGCATGCCACTCTATTCCAAAAAAAAAAAAA[A/C,AAAC,AAC,AC,AAAAC]
CTGCAAATTAGAGCTACCATCGAGTCAAATGCAATCCAGAGATGCATTTTACCTACACCTGGCTTGAGCACCACCAATAACTAAGCACTTAATCAGTTAA
TTAACTGATTAAGTGCTTAGTTATTGGTGGTGCTCAAGCCAGGTGTAGGTAAAATGCATCTCTGGATTGCATTTGACTCGATGGTAGCTCTAATTTGCAG[T/G,GTTT,GTT,GT,GTTTT]
TTTTTTTTTTTTTGGAATAGAGTGGCATGCACATTTTTCATGATATGTCCAAGACACCACATGAGGCTCTTTGCTGATAAAGGAGTAATTTTGATATAGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.10% | 15.50% | 5.52% | 10.28% | AAAC: 6.54%; AC: 1.25%; AAC: 0.40%; AAAAC: 0.36% |
| All Indica | 2759 | 43.60% | 20.30% | 9.21% | 12.69% | AAAC: 10.98%; AC: 2.07%; AAC: 0.62%; AAAAC: 0.62% |
| All Japonica | 1512 | 98.40% | 1.10% | 0.13% | 0.26% | AAAC: 0.07%; AC: 0.07% |
| Aus | 269 | 0.70% | 54.60% | 0.00% | 44.24% | AC: 0.37% |
| Indica I | 595 | 83.00% | 0.50% | 6.22% | 3.36% | AC: 5.04%; AAAC: 1.85% |
| Indica II | 465 | 66.00% | 14.20% | 2.58% | 14.84% | AAAC: 1.72%; AAC: 0.43%; AC: 0.22% |
| Indica III | 913 | 8.70% | 38.00% | 15.01% | 18.29% | AAAC: 17.31%; AAAAC: 1.53%; AAC: 0.88%; AC: 0.33% |
| Indica Intermediate | 786 | 41.00% | 18.20% | 8.65% | 11.96% | AAAC: 16.03%; AC: 2.93%; AAC: 0.89%; AAAAC: 0.38% |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 95.60% | 3.20% | 0.40% | 0.60% | AAAC: 0.20% |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.00% | AC: 0.41% |
| VI/Aromatic | 96 | 96.90% | 2.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 62.20% | 11.10% | 4.44% | 14.44% | AAAC: 5.56%; AAC: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0335411667 | A -> C | LOC_Os03g62530.1 | downstream_gene_variant ; 3085.0bp to feature; MODIFIER | silent_mutation | Average:37.5; most accessible tissue: Zhenshan97 young leaf, score: 61.386 | N | N | N | N |
| vg0335411667 | A -> C | LOC_Os03g62550.1 | downstream_gene_variant ; 2407.0bp to feature; MODIFIER | silent_mutation | Average:37.5; most accessible tissue: Zhenshan97 young leaf, score: 61.386 | N | N | N | N |
| vg0335411667 | A -> C | LOC_Os03g62539.1 | intron_variant ; MODIFIER | silent_mutation | Average:37.5; most accessible tissue: Zhenshan97 young leaf, score: 61.386 | N | N | N | N |
| vg0335411667 | A -> AAAAC | LOC_Os03g62530.1 | downstream_gene_variant ; 3086.0bp to feature; MODIFIER | silent_mutation | Average:37.5; most accessible tissue: Zhenshan97 young leaf, score: 61.386 | N | N | N | N |
| vg0335411667 | A -> AAAAC | LOC_Os03g62550.1 | downstream_gene_variant ; 2406.0bp to feature; MODIFIER | silent_mutation | Average:37.5; most accessible tissue: Zhenshan97 young leaf, score: 61.386 | N | N | N | N |
| vg0335411667 | A -> AAAAC | LOC_Os03g62539.1 | intron_variant ; MODIFIER | silent_mutation | Average:37.5; most accessible tissue: Zhenshan97 young leaf, score: 61.386 | N | N | N | N |
| vg0335411667 | A -> DEL | N | N | silent_mutation | Average:37.5; most accessible tissue: Zhenshan97 young leaf, score: 61.386 | N | N | N | N |
| vg0335411667 | A -> AC | LOC_Os03g62530.1 | downstream_gene_variant ; 3086.0bp to feature; MODIFIER | silent_mutation | Average:37.5; most accessible tissue: Zhenshan97 young leaf, score: 61.386 | N | N | N | N |
| vg0335411667 | A -> AC | LOC_Os03g62550.1 | downstream_gene_variant ; 2406.0bp to feature; MODIFIER | silent_mutation | Average:37.5; most accessible tissue: Zhenshan97 young leaf, score: 61.386 | N | N | N | N |
| vg0335411667 | A -> AC | LOC_Os03g62539.1 | intron_variant ; MODIFIER | silent_mutation | Average:37.5; most accessible tissue: Zhenshan97 young leaf, score: 61.386 | N | N | N | N |
| vg0335411667 | A -> AAC | LOC_Os03g62530.1 | downstream_gene_variant ; 3086.0bp to feature; MODIFIER | silent_mutation | Average:37.5; most accessible tissue: Zhenshan97 young leaf, score: 61.386 | N | N | N | N |
| vg0335411667 | A -> AAC | LOC_Os03g62550.1 | downstream_gene_variant ; 2406.0bp to feature; MODIFIER | silent_mutation | Average:37.5; most accessible tissue: Zhenshan97 young leaf, score: 61.386 | N | N | N | N |
| vg0335411667 | A -> AAC | LOC_Os03g62539.1 | intron_variant ; MODIFIER | silent_mutation | Average:37.5; most accessible tissue: Zhenshan97 young leaf, score: 61.386 | N | N | N | N |
| vg0335411667 | A -> AAAC | LOC_Os03g62530.1 | downstream_gene_variant ; 3086.0bp to feature; MODIFIER | silent_mutation | Average:37.5; most accessible tissue: Zhenshan97 young leaf, score: 61.386 | N | N | N | N |
| vg0335411667 | A -> AAAC | LOC_Os03g62550.1 | downstream_gene_variant ; 2406.0bp to feature; MODIFIER | silent_mutation | Average:37.5; most accessible tissue: Zhenshan97 young leaf, score: 61.386 | N | N | N | N |
| vg0335411667 | A -> AAAC | LOC_Os03g62539.1 | intron_variant ; MODIFIER | silent_mutation | Average:37.5; most accessible tissue: Zhenshan97 young leaf, score: 61.386 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0335411667 | NA | 1.59E-06 | mr1587 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335411667 | NA | 3.78E-06 | mr1020_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335411667 | NA | 6.83E-06 | mr1119_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335411667 | NA | 5.98E-06 | mr1120_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335411667 | 1.40E-07 | NA | mr1216_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335411667 | 4.81E-06 | 4.64E-07 | mr1216_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335411667 | NA | 6.34E-06 | mr1247_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335411667 | 7.34E-06 | NA | mr1263_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335411667 | NA | 2.46E-07 | mr1582_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335411667 | NA | 2.28E-07 | mr1762_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |