\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335411667:

Variant ID: vg0335411667 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 35411667
Reference Allele: AAlternative Allele: C,AAAC,AAC,AC,AAAAC
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTATATCAAAATTACTCCTTTATCAGCAAAGAGCCTCATGTGGTGTCTTGGACATATCATGAAAAATGTGCATGCCACTCTATTCCAAAAAAAAAAAAA[A/C,AAAC,AAC,AC,AAAAC]
CTGCAAATTAGAGCTACCATCGAGTCAAATGCAATCCAGAGATGCATTTTACCTACACCTGGCTTGAGCACCACCAATAACTAAGCACTTAATCAGTTAA

Reverse complement sequence

TTAACTGATTAAGTGCTTAGTTATTGGTGGTGCTCAAGCCAGGTGTAGGTAAAATGCATCTCTGGATTGCATTTGACTCGATGGTAGCTCTAATTTGCAG[T/G,GTTT,GTT,GT,GTTTT]
TTTTTTTTTTTTTGGAATAGAGTGGCATGCACATTTTTCATGATATGTCCAAGACACCACATGAGGCTCTTTGCTGATAAAGGAGTAATTTTGATATAGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.10% 15.50% 5.52% 10.28% AAAC: 6.54%; AC: 1.25%; AAC: 0.40%; AAAAC: 0.36%
All Indica  2759 43.60% 20.30% 9.21% 12.69% AAAC: 10.98%; AC: 2.07%; AAC: 0.62%; AAAAC: 0.62%
All Japonica  1512 98.40% 1.10% 0.13% 0.26% AAAC: 0.07%; AC: 0.07%
Aus  269 0.70% 54.60% 0.00% 44.24% AC: 0.37%
Indica I  595 83.00% 0.50% 6.22% 3.36% AC: 5.04%; AAAC: 1.85%
Indica II  465 66.00% 14.20% 2.58% 14.84% AAAC: 1.72%; AAC: 0.43%; AC: 0.22%
Indica III  913 8.70% 38.00% 15.01% 18.29% AAAC: 17.31%; AAAAC: 1.53%; AAC: 0.88%; AC: 0.33%
Indica Intermediate  786 41.00% 18.20% 8.65% 11.96% AAAC: 16.03%; AC: 2.93%; AAC: 0.89%; AAAAC: 0.38%
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 95.60% 3.20% 0.40% 0.60% AAAC: 0.20%
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.00% AC: 0.41%
VI/Aromatic  96 96.90% 2.10% 1.04% 0.00% NA
Intermediate  90 62.20% 11.10% 4.44% 14.44% AAAC: 5.56%; AAC: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0335411667 A -> C LOC_Os03g62530.1 downstream_gene_variant ; 3085.0bp to feature; MODIFIER silent_mutation Average:37.5; most accessible tissue: Zhenshan97 young leaf, score: 61.386 N N N N
vg0335411667 A -> C LOC_Os03g62550.1 downstream_gene_variant ; 2407.0bp to feature; MODIFIER silent_mutation Average:37.5; most accessible tissue: Zhenshan97 young leaf, score: 61.386 N N N N
vg0335411667 A -> C LOC_Os03g62539.1 intron_variant ; MODIFIER silent_mutation Average:37.5; most accessible tissue: Zhenshan97 young leaf, score: 61.386 N N N N
vg0335411667 A -> AAAAC LOC_Os03g62530.1 downstream_gene_variant ; 3086.0bp to feature; MODIFIER silent_mutation Average:37.5; most accessible tissue: Zhenshan97 young leaf, score: 61.386 N N N N
vg0335411667 A -> AAAAC LOC_Os03g62550.1 downstream_gene_variant ; 2406.0bp to feature; MODIFIER silent_mutation Average:37.5; most accessible tissue: Zhenshan97 young leaf, score: 61.386 N N N N
vg0335411667 A -> AAAAC LOC_Os03g62539.1 intron_variant ; MODIFIER silent_mutation Average:37.5; most accessible tissue: Zhenshan97 young leaf, score: 61.386 N N N N
vg0335411667 A -> DEL N N silent_mutation Average:37.5; most accessible tissue: Zhenshan97 young leaf, score: 61.386 N N N N
vg0335411667 A -> AC LOC_Os03g62530.1 downstream_gene_variant ; 3086.0bp to feature; MODIFIER silent_mutation Average:37.5; most accessible tissue: Zhenshan97 young leaf, score: 61.386 N N N N
vg0335411667 A -> AC LOC_Os03g62550.1 downstream_gene_variant ; 2406.0bp to feature; MODIFIER silent_mutation Average:37.5; most accessible tissue: Zhenshan97 young leaf, score: 61.386 N N N N
vg0335411667 A -> AC LOC_Os03g62539.1 intron_variant ; MODIFIER silent_mutation Average:37.5; most accessible tissue: Zhenshan97 young leaf, score: 61.386 N N N N
vg0335411667 A -> AAC LOC_Os03g62530.1 downstream_gene_variant ; 3086.0bp to feature; MODIFIER silent_mutation Average:37.5; most accessible tissue: Zhenshan97 young leaf, score: 61.386 N N N N
vg0335411667 A -> AAC LOC_Os03g62550.1 downstream_gene_variant ; 2406.0bp to feature; MODIFIER silent_mutation Average:37.5; most accessible tissue: Zhenshan97 young leaf, score: 61.386 N N N N
vg0335411667 A -> AAC LOC_Os03g62539.1 intron_variant ; MODIFIER silent_mutation Average:37.5; most accessible tissue: Zhenshan97 young leaf, score: 61.386 N N N N
vg0335411667 A -> AAAC LOC_Os03g62530.1 downstream_gene_variant ; 3086.0bp to feature; MODIFIER silent_mutation Average:37.5; most accessible tissue: Zhenshan97 young leaf, score: 61.386 N N N N
vg0335411667 A -> AAAC LOC_Os03g62550.1 downstream_gene_variant ; 2406.0bp to feature; MODIFIER silent_mutation Average:37.5; most accessible tissue: Zhenshan97 young leaf, score: 61.386 N N N N
vg0335411667 A -> AAAC LOC_Os03g62539.1 intron_variant ; MODIFIER silent_mutation Average:37.5; most accessible tissue: Zhenshan97 young leaf, score: 61.386 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0335411667 NA 1.59E-06 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335411667 NA 3.78E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335411667 NA 6.83E-06 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335411667 NA 5.98E-06 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335411667 1.40E-07 NA mr1216_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335411667 4.81E-06 4.64E-07 mr1216_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335411667 NA 6.34E-06 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335411667 7.34E-06 NA mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335411667 NA 2.46E-07 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335411667 NA 2.28E-07 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251