\
| Variant ID: vg0335357986 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 35357986 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TTAAGGATTAGTACCAGACCACAAATCATACAAAACCTCAGCACTTGGCACACAAAAGTTACTACGATTGATCCCCCTAAGGAGGACCACCAGTTCACCA[C/T]
TGATCACATTTCAAACATATTCTAGGCAGTATGAGAACTAATACTATCAATGGCTAAACATGAATTAGAAGGGATCTAAACCGTGACGTGCTGAAAACCA
TGGTTTTCAGCACGTCACGGTTTAGATCCCTTCTAATTCATGTTTAGCCATTGATAGTATTAGTTCTCATACTGCCTAGAATATGTTTGAAATGTGATCA[G/A]
TGGTGAACTGGTGGTCCTCCTTAGGGGGATCAATCGTAGTAACTTTTGTGTGCCAAGTGCTGAGGTTTTGTATGATTTGTGGTCTGGTACTAATCCTTAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.70% | 23.30% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 47.00% | 53.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 86.50% | 13.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 10.40% | 89.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 66.40% | 33.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 21.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0335357986 | C -> T | LOC_Os03g62410.1 | upstream_gene_variant ; 3089.0bp to feature; MODIFIER | silent_mutation | Average:54.478; most accessible tissue: Callus, score: 77.524 | N | N | N | N |
| vg0335357986 | C -> T | LOC_Os03g62410.2 | upstream_gene_variant ; 3089.0bp to feature; MODIFIER | silent_mutation | Average:54.478; most accessible tissue: Callus, score: 77.524 | N | N | N | N |
| vg0335357986 | C -> T | LOC_Os03g62430.1 | downstream_gene_variant ; 2747.0bp to feature; MODIFIER | silent_mutation | Average:54.478; most accessible tissue: Callus, score: 77.524 | N | N | N | N |
| vg0335357986 | C -> T | LOC_Os03g62420.1 | intron_variant ; MODIFIER | silent_mutation | Average:54.478; most accessible tissue: Callus, score: 77.524 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0335357986 | 6.33E-08 | 7.41E-06 | Awn_length | Ind_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0335357986 | 8.30E-06 | 3.50E-07 | mr1117_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335357986 | 2.91E-06 | 6.35E-08 | mr1119_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335357986 | NA | 2.58E-07 | mr1180_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335357986 | NA | 5.42E-07 | mr1183_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335357986 | NA | 3.05E-07 | mr1338_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335357986 | NA | 3.92E-06 | mr1730_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335357986 | NA | 2.77E-07 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335357986 | NA | 2.96E-08 | mr1794_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335357986 | NA | 5.24E-06 | mr1910_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |