\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335357986:

Variant ID: vg0335357986 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 35357986
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAAGGATTAGTACCAGACCACAAATCATACAAAACCTCAGCACTTGGCACACAAAAGTTACTACGATTGATCCCCCTAAGGAGGACCACCAGTTCACCA[C/T]
TGATCACATTTCAAACATATTCTAGGCAGTATGAGAACTAATACTATCAATGGCTAAACATGAATTAGAAGGGATCTAAACCGTGACGTGCTGAAAACCA

Reverse complement sequence

TGGTTTTCAGCACGTCACGGTTTAGATCCCTTCTAATTCATGTTTAGCCATTGATAGTATTAGTTCTCATACTGCCTAGAATATGTTTGAAATGTGATCA[G/A]
TGGTGAACTGGTGGTCCTCCTTAGGGGGATCAATCGTAGTAACTTTTGTGTGCCAAGTGCTGAGGTTTTGTATGATTTGTGGTCTGGTACTAATCCTTAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.70% 23.30% 0.00% 0.00% NA
All Indica  2759 90.00% 10.00% 0.00% 0.00% NA
All Japonica  1512 47.00% 53.00% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 86.70% 13.30% 0.00% 0.00% NA
Indica III  913 86.50% 13.50% 0.00% 0.00% NA
Indica Intermediate  786 88.90% 11.10% 0.00% 0.00% NA
Temperate Japonica  767 10.40% 89.60% 0.00% 0.00% NA
Tropical Japonica  504 93.30% 6.70% 0.00% 0.00% NA
Japonica Intermediate  241 66.40% 33.60% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0335357986 C -> T LOC_Os03g62410.1 upstream_gene_variant ; 3089.0bp to feature; MODIFIER silent_mutation Average:54.478; most accessible tissue: Callus, score: 77.524 N N N N
vg0335357986 C -> T LOC_Os03g62410.2 upstream_gene_variant ; 3089.0bp to feature; MODIFIER silent_mutation Average:54.478; most accessible tissue: Callus, score: 77.524 N N N N
vg0335357986 C -> T LOC_Os03g62430.1 downstream_gene_variant ; 2747.0bp to feature; MODIFIER silent_mutation Average:54.478; most accessible tissue: Callus, score: 77.524 N N N N
vg0335357986 C -> T LOC_Os03g62420.1 intron_variant ; MODIFIER silent_mutation Average:54.478; most accessible tissue: Callus, score: 77.524 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0335357986 6.33E-08 7.41E-06 Awn_length Ind_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0335357986 8.30E-06 3.50E-07 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335357986 2.91E-06 6.35E-08 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335357986 NA 2.58E-07 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335357986 NA 5.42E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335357986 NA 3.05E-07 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335357986 NA 3.92E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335357986 NA 2.77E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335357986 NA 2.96E-08 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335357986 NA 5.24E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251