\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335324797:

Variant ID: vg0335324797 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 35324797
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGCTAGCCGGTCGATCTTTTTGATGTGCGGTTGTGTTGGTCCTCCTATAGTCGACATGAGCAACGCCCTGATTTGTCATCACACGGCGATAATGCAATCT[A/G]
AAATACTCGCTCCGTCTTATAATATAACAATAAAGTAGAATATCCCCGTAAAAATAAATCTAGTAGAATATAAGATATATCTTAATACGATGAATCTGAA

Reverse complement sequence

TTCAGATTCATCGTATTAAGATATATCTTATATTCTACTAGATTTATTTTTACGGGGATATTCTACTTTATTGTTATATTATAAGACGGAGCGAGTATTT[T/C]
AGATTGCATTATCGCCGTGTGATGACAAATCAGGGCGTTGCTCATGTCGACTATAGGAGGACCAACACAACCGCACATCAAAAAGATCGACCGGCTAGCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.10% 30.50% 1.38% 0.97% NA
All Indica  2759 78.60% 17.60% 2.21% 1.59% NA
All Japonica  1512 45.40% 54.40% 0.13% 0.07% NA
Aus  269 60.20% 39.40% 0.00% 0.37% NA
Indica I  595 92.60% 2.40% 1.18% 3.87% NA
Indica II  465 77.00% 20.40% 2.58% 0.00% NA
Indica III  913 72.30% 23.90% 2.74% 1.10% NA
Indica Intermediate  786 76.30% 20.10% 2.16% 1.40% NA
Temperate Japonica  767 10.20% 89.70% 0.13% 0.00% NA
Tropical Japonica  504 89.30% 10.50% 0.20% 0.00% NA
Japonica Intermediate  241 65.60% 34.00% 0.00% 0.41% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 67.80% 30.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0335324797 A -> DEL N N silent_mutation Average:64.629; most accessible tissue: Callus, score: 97.133 N N N N
vg0335324797 A -> G LOC_Os03g62350.1 upstream_gene_variant ; 1963.0bp to feature; MODIFIER silent_mutation Average:64.629; most accessible tissue: Callus, score: 97.133 N N N N
vg0335324797 A -> G LOC_Os03g62340-LOC_Os03g62350 intergenic_region ; MODIFIER silent_mutation Average:64.629; most accessible tissue: Callus, score: 97.133 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0335324797 A G -0.15 -0.04 -0.03 -0.02 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0335324797 NA 1.01E-06 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335324797 NA 6.78E-08 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335324797 7.48E-07 6.24E-09 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335324797 NA 9.19E-08 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335324797 NA 2.58E-07 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335324797 NA 5.42E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335324797 NA 1.69E-06 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335324797 NA 9.91E-07 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335324797 NA 2.29E-06 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335324797 NA 7.85E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335324797 NA 3.05E-07 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335324797 3.50E-06 9.00E-06 mr1504_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335324797 NA 2.60E-06 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335324797 NA 3.92E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335324797 NA 2.96E-08 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251