Variant ID: vg0335323103 (JBrowse) | Variation Type: SNP |
Chromosome: chr03 | Position: 35323103 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 103. )
AATTTGAGGTTTTTATCATCGAAAATTATTTTTCATCCTTTTTTTTTATACTAGTTAAGAACACGCACGTATATAAAAGTTTTATTCATAAATTATATTC[C/T]
ATTTGCAAATATGCTGTTTGGTTTATTTCCTGAATAAGTGAAACGATGGGTAGTATCAGTATATATAATACCAAACTCGTGATTAAACTTGATGTAGTTA
TAACTACATCAAGTTTAATCACGAGTTTGGTATTATATATACTGATACTACCCATCGTTTCACTTATTCAGGAAATAAACCAAACAGCATATTTGCAAAT[G/A]
GAATATAATTTATGAATAAAACTTTTATATACGTGCGTGTTCTTAACTAGTATAAAAAAAAAGGATGAAAAATAATTTTCGATGATAAAAACCTCAAATT
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 28.10% | 19.00% | 5.23% | 47.65% | NA |
All Indica | 2759 | 18.10% | 24.90% | 6.45% | 50.53% | NA |
All Japonica | 1512 | 53.20% | 8.50% | 1.26% | 37.04% | NA |
Aus | 269 | 0.40% | 17.50% | 14.87% | 67.29% | NA |
Indica I | 595 | 0.80% | 22.90% | 11.26% | 65.04% | NA |
Indica II | 465 | 15.10% | 25.80% | 6.45% | 52.69% | NA |
Indica III | 913 | 33.20% | 24.20% | 2.52% | 40.09% | NA |
Indica Intermediate | 786 | 15.50% | 26.70% | 7.38% | 50.38% | NA |
Temperate Japonica | 767 | 89.70% | 0.90% | 0.13% | 9.26% | NA |
Tropical Japonica | 504 | 6.90% | 19.80% | 2.58% | 70.63% | NA |
Japonica Intermediate | 241 | 34.00% | 8.70% | 2.07% | 55.19% | NA |
VI/Aromatic | 96 | 3.10% | 15.60% | 5.21% | 76.04% | NA |
Intermediate | 90 | 22.20% | 23.30% | 5.56% | 48.89% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0335323103 | C -> T | LOC_Os03g62350.1 | upstream_gene_variant ; 3657.0bp to feature; MODIFIER | silent_mutation | Average:59.218; most accessible tissue: Minghui63 root, score: 79.522 | N | N | N | N |
vg0335323103 | C -> T | LOC_Os03g62340-LOC_Os03g62350 | intergenic_region ; MODIFIER | silent_mutation | Average:59.218; most accessible tissue: Minghui63 root, score: 79.522 | N | N | N | N |
vg0335323103 | C -> DEL | N | N | silent_mutation | Average:59.218; most accessible tissue: Minghui63 root, score: 79.522 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0335323103 | 1.02E-06 | 1.98E-07 | mr1117_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0335323103 | 3.20E-07 | 6.32E-08 | mr1119_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0335323103 | 3.19E-07 | NA | mr1123_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0335323103 | NA | 2.58E-07 | mr1180_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0335323103 | NA | 5.42E-07 | mr1183_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0335323103 | NA | 1.69E-06 | mr1229_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0335323103 | 9.49E-06 | NA | mr1247_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0335323103 | NA | 3.05E-07 | mr1338_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0335323103 | NA | 3.92E-06 | mr1730_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0335323103 | NA | 3.08E-08 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0335323103 | NA | 2.96E-08 | mr1794_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |