\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335323103:

Variant ID: vg0335323103 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 35323103
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


AATTTGAGGTTTTTATCATCGAAAATTATTTTTCATCCTTTTTTTTTATACTAGTTAAGAACACGCACGTATATAAAAGTTTTATTCATAAATTATATTC[C/T]
ATTTGCAAATATGCTGTTTGGTTTATTTCCTGAATAAGTGAAACGATGGGTAGTATCAGTATATATAATACCAAACTCGTGATTAAACTTGATGTAGTTA

Reverse complement sequence

TAACTACATCAAGTTTAATCACGAGTTTGGTATTATATATACTGATACTACCCATCGTTTCACTTATTCAGGAAATAAACCAAACAGCATATTTGCAAAT[G/A]
GAATATAATTTATGAATAAAACTTTTATATACGTGCGTGTTCTTAACTAGTATAAAAAAAAAGGATGAAAAATAATTTTCGATGATAAAAACCTCAAATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.10% 19.00% 5.23% 47.65% NA
All Indica  2759 18.10% 24.90% 6.45% 50.53% NA
All Japonica  1512 53.20% 8.50% 1.26% 37.04% NA
Aus  269 0.40% 17.50% 14.87% 67.29% NA
Indica I  595 0.80% 22.90% 11.26% 65.04% NA
Indica II  465 15.10% 25.80% 6.45% 52.69% NA
Indica III  913 33.20% 24.20% 2.52% 40.09% NA
Indica Intermediate  786 15.50% 26.70% 7.38% 50.38% NA
Temperate Japonica  767 89.70% 0.90% 0.13% 9.26% NA
Tropical Japonica  504 6.90% 19.80% 2.58% 70.63% NA
Japonica Intermediate  241 34.00% 8.70% 2.07% 55.19% NA
VI/Aromatic  96 3.10% 15.60% 5.21% 76.04% NA
Intermediate  90 22.20% 23.30% 5.56% 48.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0335323103 C -> T LOC_Os03g62350.1 upstream_gene_variant ; 3657.0bp to feature; MODIFIER silent_mutation Average:59.218; most accessible tissue: Minghui63 root, score: 79.522 N N N N
vg0335323103 C -> T LOC_Os03g62340-LOC_Os03g62350 intergenic_region ; MODIFIER silent_mutation Average:59.218; most accessible tissue: Minghui63 root, score: 79.522 N N N N
vg0335323103 C -> DEL N N silent_mutation Average:59.218; most accessible tissue: Minghui63 root, score: 79.522 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0335323103 1.02E-06 1.98E-07 mr1117_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335323103 3.20E-07 6.32E-08 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335323103 3.19E-07 NA mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335323103 NA 2.58E-07 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335323103 NA 5.42E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335323103 NA 1.69E-06 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335323103 9.49E-06 NA mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335323103 NA 3.05E-07 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335323103 NA 3.92E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335323103 NA 3.08E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335323103 NA 2.96E-08 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251