\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335289141:

Variant ID: vg0335289141 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 35289141
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCGAGGATGGGGGCGGTAGGAGGAGCAGCCACCTCCTGTGGCGAGGATGGGGGCGGGACGGGCAGGGGTAGGGACCTTGAGGCGAGGTAGTGACGAATG[G/A]
GATGGGATCGACAGCATTGGGCTGGTGCCATCCATCGTTGTCGCCATCCATAAGCTCAACTTCCTCTGTCGTCCACAAGCTCACCGGCGACAATAGTCCC

Reverse complement sequence

GGGACTATTGTCGCCGGTGAGCTTGTGGACGACAGAGGAAGTTGAGCTTATGGATGGCGACAACGATGGATGGCACCAGCCCAATGCTGTCGATCCCATC[C/T]
CATTCGTCACTACCTCGCCTCAAGGTCCCTACCCCTGCCCGTCCCGCCCCCATCCTCGCCACAGGAGGTGGCTGCTCCTCCTACCGCCCCCATCCTCGCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.60% 6.60% 1.74% 0.00% NA
All Indica  2759 99.20% 0.10% 0.69% 0.00% NA
All Japonica  1512 76.10% 20.00% 3.90% 0.00% NA
Aus  269 98.90% 0.00% 1.12% 0.00% NA
Indica I  595 97.50% 0.20% 2.35% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.10% 0.30% 0.64% 0.00% NA
Temperate Japonica  767 94.70% 2.90% 2.48% 0.00% NA
Tropical Japonica  504 61.10% 34.70% 4.17% 0.00% NA
Japonica Intermediate  241 48.10% 44.00% 7.88% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 93.30% 5.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0335289141 G -> A LOC_Os03g62290.1 missense_variant ; p.Pro18Ser; MODERATE nonsynonymous_codon ; P18S Average:73.498; most accessible tissue: Zhenshan97 young leaf, score: 83.412 unknown unknown DELETERIOUS 0.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0335289141 2.48E-06 2.48E-06 mr1159_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335289141 5.63E-06 5.63E-06 mr1312_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335289141 6.04E-07 6.04E-07 mr1369_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335289141 NA 1.40E-06 mr1397_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335289141 6.86E-06 6.86E-06 mr1440_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335289141 1.91E-07 1.91E-07 mr1453_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335289141 NA 5.47E-08 mr1544_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335289141 NA 1.40E-06 mr1556_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335289141 5.04E-06 5.03E-06 mr1663_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335289141 NA 4.72E-06 mr1665_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335289141 NA 6.62E-06 mr1683_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335289141 NA 4.39E-06 mr1738_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335289141 NA 7.34E-06 mr1759_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335289141 NA 5.79E-06 mr1764_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335289141 5.20E-06 5.20E-06 mr1811_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335289141 NA 2.08E-06 mr1812_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335289141 NA 4.42E-06 mr1833_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335289141 7.80E-06 7.79E-06 mr1843_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335289141 NA 3.15E-10 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251