\
| Variant ID: vg0335235562 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 35235562 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CGAATCATAATAACATTCTATTATCCTTTACCTAATCCTAGAACGAGCTTATTTTCTTTAGCTCCGATAAATGTTCAATGGTAATCATGGCCACCTCAAA[G/A]
AACTATAGCTTATAGCAACGATGTGAAGGTATACAATTTTTTTTACGTTTAATATAAAACAAATCACTACACCAGGATACAATTTTTTTTGTTGTTAAAT
ATTTAACAACAAAAAAAATTGTATCCTGGTGTAGTGATTTGTTTTATATTAAACGTAAAAAAAATTGTATACCTTCACATCGTTGCTATAAGCTATAGTT[C/T]
TTTGAGGTGGCCATGATTACCATTGAACATTTATCGGAGCTAAAGAAAATAAGCTCGTTCTAGGATTAGGTAAAGGATAATAGAATGTTATTATGATTCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.20% | 2.70% | 1.76% | 20.33% | NA |
| All Indica | 2759 | 64.50% | 0.30% | 1.12% | 34.11% | NA |
| All Japonica | 1512 | 88.60% | 7.70% | 3.44% | 0.20% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 58.50% | 0.70% | 1.34% | 39.50% | NA |
| Indica II | 465 | 75.10% | 0.00% | 0.86% | 24.09% | NA |
| Indica III | 913 | 57.50% | 0.00% | 1.42% | 41.07% | NA |
| Indica Intermediate | 786 | 71.00% | 0.40% | 0.76% | 27.86% | NA |
| Temperate Japonica | 767 | 80.30% | 13.30% | 6.39% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 0.40% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 93.40% | 5.40% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 2.20% | 0.00% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0335235562 | G -> A | LOC_Os03g62200.1 | upstream_gene_variant ; 2693.0bp to feature; MODIFIER | silent_mutation | Average:31.495; most accessible tissue: Callus, score: 87.323 | N | N | N | N |
| vg0335235562 | G -> A | LOC_Os03g62190.1 | downstream_gene_variant ; 4619.0bp to feature; MODIFIER | silent_mutation | Average:31.495; most accessible tissue: Callus, score: 87.323 | N | N | N | N |
| vg0335235562 | G -> A | LOC_Os03g62190-LOC_Os03g62200 | intergenic_region ; MODIFIER | silent_mutation | Average:31.495; most accessible tissue: Callus, score: 87.323 | N | N | N | N |
| vg0335235562 | G -> DEL | N | N | silent_mutation | Average:31.495; most accessible tissue: Callus, score: 87.323 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0335235562 | 2.93E-06 | NA | mr1024 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335235562 | NA | 3.15E-08 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335235562 | 4.99E-08 | NA | mr1024_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335235562 | 5.81E-06 | 5.81E-06 | mr1024_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335235562 | NA | 9.18E-07 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335235562 | NA | 2.07E-06 | mr1565_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335235562 | NA | 7.12E-06 | mr1913_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |