\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335111562:

Variant ID: vg0335111562 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 35111562
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:


CAGCCGCATCGCCTCTGCCGATGGCATACTTCCAAGCCCATGCCAGCTGAAAATACAAATGTGTAAAGAGACGATCATGCTTTAAAGACATGCAGTATCA[A/G]
CATTTGATTGAAGGTCTATGGATATTCCTGCCACCGGTCAGCTCTCTAGCTTATCAGTCCAAAATTTAAATTACACAAGACAGAAATCCTCTTCTAACTT

Reverse complement sequence

AAGTTAGAAGAGGATTTCTGTCTTGTGTAATTTAAATTTTGGACTGATAAGCTAGAGAGCTGACCGGTGGCAGGAATATCCATAGACCTTCAATCAAATG[T/C]
TGATACTGCATGTCTTTAAAGCATGATCGTCTCTTTACACATTTGTATTTTCAGCTGGCATGGGCTTGGAAGTATGCCATCGGCAGAGGCGATGCGGCTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.00% 5.00% 0.00% 0.00% NA
All Indica  2759 93.60% 6.40% 0.00% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 81.00% 19.00% 0.00% 0.00% NA
Indica I  595 97.30% 2.70% 0.00% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 90.80% 9.20% 0.00% 0.00% NA
Indica Intermediate  786 91.10% 8.90% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0335111562 A -> G LOC_Os03g61950.1 upstream_gene_variant ; 3707.0bp to feature; MODIFIER silent_mutation Average:70.309; most accessible tissue: Minghui63 flag leaf, score: 83.197 N N N N
vg0335111562 A -> G LOC_Os03g61930.3 upstream_gene_variant ; 155.0bp to feature; MODIFIER silent_mutation Average:70.309; most accessible tissue: Minghui63 flag leaf, score: 83.197 N N N N
vg0335111562 A -> G LOC_Os03g61950.2 upstream_gene_variant ; 3707.0bp to feature; MODIFIER silent_mutation Average:70.309; most accessible tissue: Minghui63 flag leaf, score: 83.197 N N N N
vg0335111562 A -> G LOC_Os03g61940.1 downstream_gene_variant ; 2199.0bp to feature; MODIFIER silent_mutation Average:70.309; most accessible tissue: Minghui63 flag leaf, score: 83.197 N N N N
vg0335111562 A -> G LOC_Os03g61930.1 intron_variant ; MODIFIER silent_mutation Average:70.309; most accessible tissue: Minghui63 flag leaf, score: 83.197 N N N N
vg0335111562 A -> G LOC_Os03g61930.2 intron_variant ; MODIFIER silent_mutation Average:70.309; most accessible tissue: Minghui63 flag leaf, score: 83.197 N N N N
vg0335111562 A -> G LOC_Os03g61930.4 intron_variant ; MODIFIER silent_mutation Average:70.309; most accessible tissue: Minghui63 flag leaf, score: 83.197 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0335111562 6.14E-08 NA mr1151 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335111562 1.07E-06 NA mr1249 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335111562 NA 9.25E-06 mr1019_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251