\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0334809884:

Variant ID: vg0334809884 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 34809884
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


CCATCCACAATTTCTTTCTGTCAGTTTCCTTGACTGTCAAAATACTACTCCCTCTGTCCCTAAATATTTGACGCCGTTGACTTTTTTAAACATGTTGGAC[C/T]
GTTCGTCTTATTCAAAAAATTTAAGTAATTATTAATTCTTTTCCTATCATTTGATTCATTGTTAAATATACTACTACTACTCAAGTTTTTTAATAATATT

Reverse complement sequence

AATATTATTAAAAAACTTGAGTAGTAGTAGTATATTTAACAATGAATCAAATGATAGGAAAAGAATTAATAATTACTTAAATTTTTTGAATAAGACGAAC[G/A]
GTCCAACATGTTTAAAAAAGTCAACGGCGTCAAATATTTAGGGACAGAGGGAGTAGTATTTTGACAGTCAAGGAAACTGACAGAAAGAAATTGTGGATGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.70% 9.30% 0.02% 0.00% NA
All Indica  2759 84.50% 15.50% 0.04% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.50% 1.50% 0.00% 0.00% NA
Indica II  465 95.10% 4.90% 0.00% 0.00% NA
Indica III  913 68.80% 31.20% 0.00% 0.00% NA
Indica Intermediate  786 85.80% 14.10% 0.13% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0334809884 C -> T LOC_Os03g61310.1 upstream_gene_variant ; 193.0bp to feature; MODIFIER silent_mutation Average:45.451; most accessible tissue: Zhenshan97 root, score: 66.982 N N N N
vg0334809884 C -> T LOC_Os03g61290.1 downstream_gene_variant ; 1978.0bp to feature; MODIFIER silent_mutation Average:45.451; most accessible tissue: Zhenshan97 root, score: 66.982 N N N N
vg0334809884 C -> T LOC_Os03g61319.1 downstream_gene_variant ; 4253.0bp to feature; MODIFIER silent_mutation Average:45.451; most accessible tissue: Zhenshan97 root, score: 66.982 N N N N
vg0334809884 C -> T LOC_Os03g61290-LOC_Os03g61310 intergenic_region ; MODIFIER silent_mutation Average:45.451; most accessible tissue: Zhenshan97 root, score: 66.982 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0334809884 4.44E-06 3.55E-07 mr1094 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334809884 NA 7.15E-06 mr1305 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334809884 7.21E-06 7.21E-06 mr1355 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334809884 NA 7.40E-06 mr1765 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334809884 NA 5.15E-06 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251