\
| Variant ID: vg0334712576 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 34712576 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 104. )
TCTTTTTTCCAGTTATCGATTGAAATTTCGATGGTTTCATTCGGAATTTCGTCAAAGCCGACCGGTTTTCGCAAGCTTATCGATAAACTCAGTGTATTTG[C/T]
ATTCAAATTTTGATTTATGAAATTTGTTCAGAATCTACCAGCTTCTCATTCTGCTAGAGCATGAAAAAGAAGGCCATCTCGGAATCGTAAACTGGTGCAG
CTGCACCAGTTTACGATTCCGAGATGGCCTTCTTTTTCATGCTCTAGCAGAATGAGAAGCTGGTAGATTCTGAACAAATTTCATAAATCAAAATTTGAAT[G/A]
CAAATACACTGAGTTTATCGATAAGCTTGCGAAAACCGGTCGGCTTTGACGAAATTCCGAATGAAACCATCGAAATTTCAATCGATAACTGGAAAAAAGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.30% | 48.70% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 83.90% | 16.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 0.70% | 99.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 21.20% | 78.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 82.40% | 17.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 83.70% | 16.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 78.00% | 21.90% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 0.50% | 99.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 43.30% | 55.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0334712576 | C -> T | LOC_Os03g61100.1 | upstream_gene_variant ; 1531.0bp to feature; MODIFIER | silent_mutation | Average:86.798; most accessible tissue: Callus, score: 91.948 | N | N | N | N |
| vg0334712576 | C -> T | LOC_Os03g61110.1 | upstream_gene_variant ; 221.0bp to feature; MODIFIER | silent_mutation | Average:86.798; most accessible tissue: Callus, score: 91.948 | N | N | N | N |
| vg0334712576 | C -> T | LOC_Os03g61090.1 | downstream_gene_variant ; 4610.0bp to feature; MODIFIER | silent_mutation | Average:86.798; most accessible tissue: Callus, score: 91.948 | N | N | N | N |
| vg0334712576 | C -> T | LOC_Os03g61120.1 | downstream_gene_variant ; 2820.0bp to feature; MODIFIER | silent_mutation | Average:86.798; most accessible tissue: Callus, score: 91.948 | N | N | N | N |
| vg0334712576 | C -> T | LOC_Os03g61100-LOC_Os03g61110 | intergenic_region ; MODIFIER | silent_mutation | Average:86.798; most accessible tissue: Callus, score: 91.948 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0334712576 | NA | 8.65E-22 | mr1003 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334712576 | NA | 3.15E-22 | mr1051 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334712576 | NA | 6.56E-09 | mr1342 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334712576 | NA | 1.60E-11 | mr1609 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334712576 | NA | 1.16E-14 | mr1655 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334712576 | 3.49E-07 | 6.46E-64 | mr1671 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334712576 | 5.29E-07 | 7.08E-08 | mr1671 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334712576 | NA | 8.39E-26 | mr1051_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334712576 | NA | 1.07E-14 | mr1333_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334712576 | 3.74E-09 | 2.44E-83 | mr1671_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334712576 | 8.12E-10 | 4.01E-11 | mr1671_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |