\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0333924966:

Variant ID: vg0333924966 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 33924966
Reference Allele: TAAlternative Allele: AA,TAA,T
Primary Allele: AASecondary Allele: TA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATAGCCGTAATAAATCTAAATTTTGCTTCAGTAATATAGGCGATTGGTTTAAAGCCATTTTTTCCCCCAAACTATACAATCTACACTATGTTCTTTTTT[TA/AA,TAA,T]
AAAAAAAATAGCACGGTTTTACTAGTTGGAGAAGGCTGGGAAAGCACCCCCTTCTTAATTCTTAATTACGTGGTGGCTTCTCCTCCTCCGGTGAGACGGC

Reverse complement sequence

GCCGTCTCACCGGAGGAGGAGAAGCCACCACGTAATTAAGAATTAAGAAGGGGGTGCTTTCCCAGCCTTCTCCAACTAGTAAAACCGTGCTATTTTTTTT[TA/TT,TTA,A]
AAAAAAGAACATAGTGTAGATTGTATAGTTTGGGGGAAAAAATGGCTTTAAACCAATCGCCTATATTACTGAAGCAAAATTTAGATTTATTACGGCTATG

Allele Frequencies:

Populations Population SizeFrequency of AA(primary allele) Frequency of TA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.90% 40.70% 1.67% 0.06% TAA: 5.86%; T: 2.79%
All Indica  2759 81.50% 10.70% 1.78% 0.11% T: 4.75%; TAA: 1.16%
All Japonica  1512 1.10% 96.80% 1.46% 0.00% TAA: 0.60%; T: 0.07%
Aus  269 3.00% 9.30% 1.86% 0.00% TAA: 85.87%
Indica I  595 79.80% 1.30% 3.36% 0.17% T: 14.62%; TAA: 0.67%
Indica II  465 87.10% 10.10% 2.37% 0.00% TAA: 0.43%
Indica III  913 77.70% 17.20% 0.55% 0.11% T: 3.94%; TAA: 0.55%
Indica Intermediate  786 84.00% 10.60% 1.65% 0.13% TAA: 2.67%; T: 1.02%
Temperate Japonica  767 0.90% 95.80% 2.48% 0.00% TAA: 0.78%
Tropical Japonica  504 1.20% 98.00% 0.20% 0.00% TAA: 0.40%; T: 0.20%
Japonica Intermediate  241 1.20% 97.50% 0.83% 0.00% TAA: 0.41%
VI/Aromatic  96 0.00% 99.00% 0.00% 0.00% TAA: 1.04%
Intermediate  90 43.30% 48.90% 3.33% 0.00% TAA: 4.44%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0333924966 TA -> T LOC_Os03g59580.1 upstream_gene_variant ; 3869.0bp to feature; MODIFIER silent_mutation Average:81.786; most accessible tissue: Callus, score: 93.56 N N N N
vg0333924966 TA -> T LOC_Os03g59590.1 downstream_gene_variant ; 2620.0bp to feature; MODIFIER silent_mutation Average:81.786; most accessible tissue: Callus, score: 93.56 N N N N
vg0333924966 TA -> T LOC_Os03g59580-LOC_Os03g59590 intergenic_region ; MODIFIER silent_mutation Average:81.786; most accessible tissue: Callus, score: 93.56 N N N N
vg0333924966 TA -> DEL N N silent_mutation Average:81.786; most accessible tissue: Callus, score: 93.56 N N N N
vg0333924966 TA -> TAA LOC_Os03g59580.1 upstream_gene_variant ; 3870.0bp to feature; MODIFIER silent_mutation Average:81.786; most accessible tissue: Callus, score: 93.56 N N N N
vg0333924966 TA -> TAA LOC_Os03g59590.1 downstream_gene_variant ; 2619.0bp to feature; MODIFIER silent_mutation Average:81.786; most accessible tissue: Callus, score: 93.56 N N N N
vg0333924966 TA -> TAA LOC_Os03g59580-LOC_Os03g59590 intergenic_region ; MODIFIER silent_mutation Average:81.786; most accessible tissue: Callus, score: 93.56 N N N N
vg0333924966 TA -> AA LOC_Os03g59580.1 upstream_gene_variant ; 3868.0bp to feature; MODIFIER silent_mutation Average:81.786; most accessible tissue: Callus, score: 93.56 N N N N
vg0333924966 TA -> AA LOC_Os03g59590.1 downstream_gene_variant ; 2621.0bp to feature; MODIFIER silent_mutation Average:81.786; most accessible tissue: Callus, score: 93.56 N N N N
vg0333924966 TA -> AA LOC_Os03g59580-LOC_Os03g59590 intergenic_region ; MODIFIER silent_mutation Average:81.786; most accessible tissue: Callus, score: 93.56 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0333924966 TA AA 0.0 0.0 -0.01 0.0 0.0 0.0
vg0333924966 TA T -0.25 -0.19 -0.22 -0.04 -0.07 -0.08
vg0333924966 TA TAA -0.11 0.03 0.04 0.01 0.06 0.11

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0333924966 NA 3.50E-26 mr1037 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333924966 NA 1.69E-43 mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333924966 NA 3.13E-49 mr1798 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333924966 NA 5.82E-07 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333924966 NA 1.27E-12 mr1914 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333924966 NA 2.89E-09 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333924966 NA 9.54E-13 mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333924966 NA 5.54E-12 mr1338_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333924966 NA 3.24E-48 mr1458_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333924966 NA 1.27E-21 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333924966 NA 1.81E-09 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251