Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0333662864:

Variant ID: vg0333662864 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 33662864
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTCACTTTCAGTGAAATTGGCGATTTCCATATGTCCATCCCTCTAAGGTTAGAGAAACGCCAAGGGATCTTTTAGCTAGCTCCACAAGATGGTGGGCTAG[C/T]
CGGCCAGTGTTCGAAGTCTCACCCTTTCTATTTATTTAATATTAGGTATTTTCCTAATATTTGTGTTTTTTTTTTCATCCCTCTAAGGTCCCTAACACAA

Reverse complement sequence

TTGTGTTAGGGACCTTAGAGGGATGAAAAAAAAAACACAAATATTAGGAAAATACCTAATATTAAATAAATAGAAAGGGTGAGACTTCGAACACTGGCCG[G/A]
CTAGCCCACCATCTTGTGGAGCTAGCTAAAAGATCCCTTGGCGTTTCTCTAACCTTAGAGGGATGGACATATGGAAATCGCCAATTTCACTGAAAGTGAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.90%	18.00%	0.04%	0.00%	NA
All Indica	2759	79.10%	20.80%	0.07%	0.00%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	1.50%	98.50%	0.00%	0.00%	NA
Indica I	595	70.40%	29.60%	0.00%	0.00%	NA
Indica II	465	96.30%	3.70%	0.00%	0.00%	NA
Indica III	913	76.80%	23.10%	0.11%	0.00%	NA
Indica Intermediate	786	78.20%	21.60%	0.13%	0.00%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0333662864	C -> T	LOC_Os03g59140.1	upstream_gene_variant ; 4849.0bp to feature; MODIFIER	silent_mutation	Average:39.554; most accessible tissue: Zhenshan97 young leaf, score: 53.314	N	N	N	N
vg0333662864	C -> T	LOC_Os03g59120.1	downstream_gene_variant ; 910.0bp to feature; MODIFIER	silent_mutation	Average:39.554; most accessible tissue: Zhenshan97 young leaf, score: 53.314	N	N	N	N
vg0333662864	C -> T	LOC_Os03g59120-LOC_Os03g59140	intergenic_region ; MODIFIER	silent_mutation	Average:39.554; most accessible tissue: Zhenshan97 young leaf, score: 53.314	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0333662864	NA	8.66E-07	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333662864	NA	1.14E-06	mr1286	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333662864	NA	1.07E-06	mr1556	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333662864	NA	2.23E-06	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333662864	3.58E-06	NA	mr1707	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333662864	NA	7.34E-08	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333662864	NA	4.79E-08	mr1707_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333662864	NA	3.93E-06	mr1723_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333662864	6.28E-07	7.47E-07	mr1834_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333662864	3.17E-07	2.14E-08	mr1834_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251