\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0333619008:

Variant ID: vg0333619008 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 33619008
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, A: 0.02, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


ATGCTAGATTTCTATCTTTCTTTTTTTAAAAAAATAAAAGGAGAACATGTTTCACGTCACAGATGACCTTGCAGGCATATTTGGAGATACCGGTAAATAA[T/A]
TTTGAGTATCGTTTTGTTAGGGCAAGGTTCCACCAGCACAAATCAGTTTCATGGTGCTGAATCCAATGCCCTGCACCTACAGGACACTTTGCATATGCAT

Reverse complement sequence

ATGCATATGCAAAGTGTCCTGTAGGTGCAGGGCATTGGATTCAGCACCATGAAACTGATTTGTGCTGGTGGAACCTTGCCCTAACAAAACGATACTCAAA[A/T]
TTATTTACCGGTATCTCCAAATATGCCTGCAAGGTCATCTGTGACGTGAAACATGTTCTCCTTTTATTTTTTTAAAAAAAGAAAGATAGAAATCTAGCAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.80% 11.10% 0.02% 0.00% NA
All Indica  2759 90.70% 9.20% 0.04% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 2.60% 97.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 86.70% 13.30% 0.00% 0.00% NA
Indica III  913 87.40% 12.60% 0.00% 0.00% NA
Indica Intermediate  786 89.90% 9.90% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0333619008 T -> A LOC_Os03g59050.1 upstream_gene_variant ; 1227.0bp to feature; MODIFIER silent_mutation Average:54.967; most accessible tissue: Callus, score: 87.358 N N N N
vg0333619008 T -> A LOC_Os03g59060.1 upstream_gene_variant ; 2902.0bp to feature; MODIFIER silent_mutation Average:54.967; most accessible tissue: Callus, score: 87.358 N N N N
vg0333619008 T -> A LOC_Os03g59060.2 upstream_gene_variant ; 2902.0bp to feature; MODIFIER silent_mutation Average:54.967; most accessible tissue: Callus, score: 87.358 N N N N
vg0333619008 T -> A LOC_Os03g59050-LOC_Os03g59060 intergenic_region ; MODIFIER silent_mutation Average:54.967; most accessible tissue: Callus, score: 87.358 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0333619008 NA 1.69E-14 mr1231 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333619008 NA 3.32E-12 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333619008 NA 8.84E-24 mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333619008 NA 3.28E-08 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333619008 NA 3.48E-09 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333619008 NA 1.01E-06 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333619008 2.86E-06 4.86E-11 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333619008 NA 3.39E-06 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333619008 NA 9.04E-14 mr1193_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333619008 NA 5.00E-20 mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333619008 NA 2.25E-06 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333619008 NA 2.88E-18 mr1587_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333619008 NA 1.30E-07 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333619008 NA 3.21E-12 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333619008 NA 9.33E-09 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333619008 NA 1.29E-06 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333619008 3.24E-09 3.30E-16 mr1860_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333619008 NA 3.81E-07 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251