| Variant ID: vg0333199277 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 33199277 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 218. )
ACAAGTTTAACGTAATATGCAACAAATCTCCCCCTAAACCTTGTGCTCGCGACTTACTTCCAAAACCCCGATCCGCGAGCGTAGCTCCTCAAACCGCACT[C/T]
GACCAAGGGACTTCGTCAGTATATCAGTGACTTGATATGCAGTCCCAGTGAATTCCAACTGAACTCGACCTTCTTCCACACACTCCCGGATATAATGATA
TATCATTATATCCGGGAGTGTGTGGAAGAAGGTCGAGTTCAGTTGGAATTCACTGGGACTGCATATCAAGTCACTGATATACTGACGAAGTCCCTTGGTC[G/A]
AGTGCGGTTTGAGGAGCTACGCTCGCGGATCGGGGTTTTGGAAGTAAGTCGCGAGCACAAGGTTTAGGGGGAGATTTGTTGCATATTACGTTAAACTTGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.00% | 48.90% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 26.40% | 73.40% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 5.90% | 94.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 14.50% | 85.40% | 0.17% | 0.00% | NA |
| Indica II | 465 | 57.40% | 41.90% | 0.65% | 0.00% | NA |
| Indica III | 913 | 13.60% | 86.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 31.80% | 68.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 28.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0333199277 | C -> T | LOC_Os03g58270.1 | missense_variant ; p.Arg1169Gln; MODERATE | nonsynonymous_codon ; R1169Q | Average:57.191; most accessible tissue: Zhenshan97 flag leaf, score: 68.703 | possibly damaging |
1.569 |
DELETERIOUS | 0.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0333199277 | NA | 8.17E-13 | mr1069 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333199277 | NA | 7.45E-15 | mr1441 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333199277 | NA | 3.59E-06 | mr1441 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333199277 | 1.48E-08 | 2.37E-37 | mr1723 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333199277 | 8.00E-08 | 6.13E-10 | mr1723 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333199277 | NA | 5.88E-07 | mr1062_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333199277 | NA | 3.02E-26 | mr1441_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333199277 | 6.14E-12 | 1.67E-43 | mr1723_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333199277 | 2.55E-10 | 2.07E-13 | mr1723_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |