Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0332529432:

Variant ID: vg0332529432 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 32529432
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:

CCAGCGATGTAGCGTTTCTCCCATCACTTCCACTTTAAGTGGTCAAGTTACGACTACTGCCTGGTCCTCGACCAGCGATGTAGCGTCTCTCCCACTACTT[C/T]
CACTTTAAGTGGTCGAGTTACGACTACTGCCTAGTTCTCGACCAGAGATGTAGCGTTTCTCCCACTACTTCCACTTTAAGTGGTCGAGTTACGACTACTG

Reverse complement sequence

CAGTAGTCGTAACTCGACCACTTAAAGTGGAAGTAGTGGGAGAAACGCTACATCTCTGGTCGAGAACTAGGCAGTAGTCGTAACTCGACCACTTAAAGTG[G/A]
AAGTAGTGGGAGAGACGCTACATCGCTGGTCGAGGACCAGGCAGTAGTCGTAACTTGACCACTTAAAGTGGAAGTGATGGGAGAAACGCTACATCGCTGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.30%	8.70%	0.00%	0.00%	NA
All Indica	2759	85.50%	14.50%	0.00%	0.00%	NA
All Japonica	1512	99.80%	0.20%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	89.70%	10.30%	0.00%	0.00%	NA
Indica II	465	87.50%	12.50%	0.00%	0.00%	NA
Indica III	913	85.80%	14.20%	0.00%	0.00%	NA
Indica Intermediate	786	80.90%	19.10%	0.00%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	10.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0332529432	C -> T	LOC_Os03g57060.1	upstream_gene_variant ; 2931.0bp to feature; MODIFIER	silent_mutation	Average:35.428; most accessible tissue: Minghui63 flag leaf, score: 69.681	N	N	N	N
vg0332529432	C -> T	LOC_Os03g57070.1	upstream_gene_variant ; 2850.0bp to feature; MODIFIER	silent_mutation	Average:35.428; most accessible tissue: Minghui63 flag leaf, score: 69.681	N	N	N	N
vg0332529432	C -> T	LOC_Os03g57070.4	upstream_gene_variant ; 2848.0bp to feature; MODIFIER	silent_mutation	Average:35.428; most accessible tissue: Minghui63 flag leaf, score: 69.681	N	N	N	N
vg0332529432	C -> T	LOC_Os03g57070.3	upstream_gene_variant ; 2848.0bp to feature; MODIFIER	silent_mutation	Average:35.428; most accessible tissue: Minghui63 flag leaf, score: 69.681	N	N	N	N
vg0332529432	C -> T	LOC_Os03g57070.2	upstream_gene_variant ; 2850.0bp to feature; MODIFIER	silent_mutation	Average:35.428; most accessible tissue: Minghui63 flag leaf, score: 69.681	N	N	N	N
vg0332529432	C -> T	LOC_Os03g57050.1	downstream_gene_variant ; 4153.0bp to feature; MODIFIER	silent_mutation	Average:35.428; most accessible tissue: Minghui63 flag leaf, score: 69.681	N	N	N	N
vg0332529432	C -> T	LOC_Os03g57060-LOC_Os03g57070	intergenic_region ; MODIFIER	silent_mutation	Average:35.428; most accessible tissue: Minghui63 flag leaf, score: 69.681	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0332529432	7.05E-06	NA	mr1312	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332529432	2.82E-07	2.81E-07	mr1312	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332529432	4.71E-06	2.25E-07	mr1374	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332529432	5.76E-07	5.76E-07	mr1374	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332529432	NA	3.04E-06	mr1426	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332529432	NA	8.99E-06	mr1537	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332529432	NA	9.38E-07	mr1895	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251