\
| Variant ID: vg0332529432 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 32529432 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 300. )
CCAGCGATGTAGCGTTTCTCCCATCACTTCCACTTTAAGTGGTCAAGTTACGACTACTGCCTGGTCCTCGACCAGCGATGTAGCGTCTCTCCCACTACTT[C/T]
CACTTTAAGTGGTCGAGTTACGACTACTGCCTAGTTCTCGACCAGAGATGTAGCGTTTCTCCCACTACTTCCACTTTAAGTGGTCGAGTTACGACTACTG
CAGTAGTCGTAACTCGACCACTTAAAGTGGAAGTAGTGGGAGAAACGCTACATCTCTGGTCGAGAACTAGGCAGTAGTCGTAACTCGACCACTTAAAGTG[G/A]
AAGTAGTGGGAGAGACGCTACATCGCTGGTCGAGGACCAGGCAGTAGTCGTAACTTGACCACTTAAAGTGGAAGTGATGGGAGAAACGCTACATCGCTGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.30% | 8.70% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 85.50% | 14.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 89.70% | 10.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 87.50% | 12.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 85.80% | 14.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 80.90% | 19.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0332529432 | C -> T | LOC_Os03g57060.1 | upstream_gene_variant ; 2931.0bp to feature; MODIFIER | silent_mutation | Average:35.428; most accessible tissue: Minghui63 flag leaf, score: 69.681 | N | N | N | N |
| vg0332529432 | C -> T | LOC_Os03g57070.1 | upstream_gene_variant ; 2850.0bp to feature; MODIFIER | silent_mutation | Average:35.428; most accessible tissue: Minghui63 flag leaf, score: 69.681 | N | N | N | N |
| vg0332529432 | C -> T | LOC_Os03g57070.4 | upstream_gene_variant ; 2848.0bp to feature; MODIFIER | silent_mutation | Average:35.428; most accessible tissue: Minghui63 flag leaf, score: 69.681 | N | N | N | N |
| vg0332529432 | C -> T | LOC_Os03g57070.3 | upstream_gene_variant ; 2848.0bp to feature; MODIFIER | silent_mutation | Average:35.428; most accessible tissue: Minghui63 flag leaf, score: 69.681 | N | N | N | N |
| vg0332529432 | C -> T | LOC_Os03g57070.2 | upstream_gene_variant ; 2850.0bp to feature; MODIFIER | silent_mutation | Average:35.428; most accessible tissue: Minghui63 flag leaf, score: 69.681 | N | N | N | N |
| vg0332529432 | C -> T | LOC_Os03g57050.1 | downstream_gene_variant ; 4153.0bp to feature; MODIFIER | silent_mutation | Average:35.428; most accessible tissue: Minghui63 flag leaf, score: 69.681 | N | N | N | N |
| vg0332529432 | C -> T | LOC_Os03g57060-LOC_Os03g57070 | intergenic_region ; MODIFIER | silent_mutation | Average:35.428; most accessible tissue: Minghui63 flag leaf, score: 69.681 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0332529432 | 7.05E-06 | NA | mr1312 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0332529432 | 2.82E-07 | 2.81E-07 | mr1312 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0332529432 | 4.71E-06 | 2.25E-07 | mr1374 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0332529432 | 5.76E-07 | 5.76E-07 | mr1374 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0332529432 | NA | 3.04E-06 | mr1426 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0332529432 | NA | 8.99E-06 | mr1537 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0332529432 | NA | 9.38E-07 | mr1895 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |