\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0332529432:

Variant ID: vg0332529432 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 32529432
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:


CCAGCGATGTAGCGTTTCTCCCATCACTTCCACTTTAAGTGGTCAAGTTACGACTACTGCCTGGTCCTCGACCAGCGATGTAGCGTCTCTCCCACTACTT[C/T]
CACTTTAAGTGGTCGAGTTACGACTACTGCCTAGTTCTCGACCAGAGATGTAGCGTTTCTCCCACTACTTCCACTTTAAGTGGTCGAGTTACGACTACTG

Reverse complement sequence

CAGTAGTCGTAACTCGACCACTTAAAGTGGAAGTAGTGGGAGAAACGCTACATCTCTGGTCGAGAACTAGGCAGTAGTCGTAACTCGACCACTTAAAGTG[G/A]
AAGTAGTGGGAGAGACGCTACATCGCTGGTCGAGGACCAGGCAGTAGTCGTAACTTGACCACTTAAAGTGGAAGTGATGGGAGAAACGCTACATCGCTGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.30% 8.70% 0.00% 0.00% NA
All Indica  2759 85.50% 14.50% 0.00% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 89.70% 10.30% 0.00% 0.00% NA
Indica II  465 87.50% 12.50% 0.00% 0.00% NA
Indica III  913 85.80% 14.20% 0.00% 0.00% NA
Indica Intermediate  786 80.90% 19.10% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0332529432 C -> T LOC_Os03g57060.1 upstream_gene_variant ; 2931.0bp to feature; MODIFIER silent_mutation Average:35.428; most accessible tissue: Minghui63 flag leaf, score: 69.681 N N N N
vg0332529432 C -> T LOC_Os03g57070.1 upstream_gene_variant ; 2850.0bp to feature; MODIFIER silent_mutation Average:35.428; most accessible tissue: Minghui63 flag leaf, score: 69.681 N N N N
vg0332529432 C -> T LOC_Os03g57070.4 upstream_gene_variant ; 2848.0bp to feature; MODIFIER silent_mutation Average:35.428; most accessible tissue: Minghui63 flag leaf, score: 69.681 N N N N
vg0332529432 C -> T LOC_Os03g57070.3 upstream_gene_variant ; 2848.0bp to feature; MODIFIER silent_mutation Average:35.428; most accessible tissue: Minghui63 flag leaf, score: 69.681 N N N N
vg0332529432 C -> T LOC_Os03g57070.2 upstream_gene_variant ; 2850.0bp to feature; MODIFIER silent_mutation Average:35.428; most accessible tissue: Minghui63 flag leaf, score: 69.681 N N N N
vg0332529432 C -> T LOC_Os03g57050.1 downstream_gene_variant ; 4153.0bp to feature; MODIFIER silent_mutation Average:35.428; most accessible tissue: Minghui63 flag leaf, score: 69.681 N N N N
vg0332529432 C -> T LOC_Os03g57060-LOC_Os03g57070 intergenic_region ; MODIFIER silent_mutation Average:35.428; most accessible tissue: Minghui63 flag leaf, score: 69.681 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0332529432 7.05E-06 NA mr1312 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332529432 2.82E-07 2.81E-07 mr1312 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332529432 4.71E-06 2.25E-07 mr1374 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332529432 5.76E-07 5.76E-07 mr1374 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332529432 NA 3.04E-06 mr1426 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332529432 NA 8.99E-06 mr1537 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332529432 NA 9.38E-07 mr1895 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251