\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0332527715:

Variant ID: vg0332527715 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 32527715
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


CTGTTGTCGACTACGAGTCAGATCTTCAGACCGCCATGTCGACAACAGTTAGATAGGCTACCCCACATATTGTACTGGTGTGATTATAGTGAATAAAGAG[C/T]
AATACCGGCTTCGGCCAACAGGATGTAGGGTTATTACCTGACAATTCAGGGGCCCGAACCTGTATAAAAATCCTCGTCCCCATCTCTTTTACCTCAGTCT

Reverse complement sequence

AGACTGAGGTAAAAGAGATGGGGACGAGGATTTTTATACAGGTTCGGGCCCCTGAATTGTCAGGTAATAACCCTACATCCTGTTGGCCGAAGCCGGTATT[G/A]
CTCTTTATTCACTATAATCACACCAGTACAATATGTGGGGTAGCCTATCTAACTGTTGTCGACATGGCGGTCTGAAGATCTGACTCGTAGTCGACAACAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.90% 12.80% 8.78% 3.49% NA
All Indica  2759 67.50% 14.80% 12.00% 5.76% NA
All Japonica  1512 99.70% 0.20% 0.07% 0.00% NA
Aus  269 5.60% 65.40% 27.14% 1.86% NA
Indica I  595 56.60% 9.70% 23.70% 9.92% NA
Indica II  465 68.40% 11.60% 13.12% 6.88% NA
Indica III  913 78.50% 15.40% 3.72% 2.30% NA
Indica Intermediate  786 62.30% 19.60% 12.09% 5.98% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.20% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 6.20% 3.12% 0.00% NA
Intermediate  90 77.80% 13.30% 7.78% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0332527715 C -> T LOC_Os03g57060.1 upstream_gene_variant ; 1214.0bp to feature; MODIFIER silent_mutation Average:28.091; most accessible tissue: Minghui63 root, score: 54.099 N N N N
vg0332527715 C -> T LOC_Os03g57070.1 upstream_gene_variant ; 4567.0bp to feature; MODIFIER silent_mutation Average:28.091; most accessible tissue: Minghui63 root, score: 54.099 N N N N
vg0332527715 C -> T LOC_Os03g57070.4 upstream_gene_variant ; 4565.0bp to feature; MODIFIER silent_mutation Average:28.091; most accessible tissue: Minghui63 root, score: 54.099 N N N N
vg0332527715 C -> T LOC_Os03g57070.3 upstream_gene_variant ; 4565.0bp to feature; MODIFIER silent_mutation Average:28.091; most accessible tissue: Minghui63 root, score: 54.099 N N N N
vg0332527715 C -> T LOC_Os03g57070.2 upstream_gene_variant ; 4567.0bp to feature; MODIFIER silent_mutation Average:28.091; most accessible tissue: Minghui63 root, score: 54.099 N N N N
vg0332527715 C -> T LOC_Os03g57050.1 downstream_gene_variant ; 2436.0bp to feature; MODIFIER silent_mutation Average:28.091; most accessible tissue: Minghui63 root, score: 54.099 N N N N
vg0332527715 C -> T LOC_Os03g57060-LOC_Os03g57070 intergenic_region ; MODIFIER silent_mutation Average:28.091; most accessible tissue: Minghui63 root, score: 54.099 N N N N
vg0332527715 C -> DEL N N silent_mutation Average:28.091; most accessible tissue: Minghui63 root, score: 54.099 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0332527715 NA 5.38E-07 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715 NA 2.78E-07 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715 NA 1.06E-15 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715 NA 1.72E-08 mr1184 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715 NA 9.93E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715 NA 3.29E-06 mr1284 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715 NA 4.39E-06 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715 NA 2.69E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715 NA 3.22E-06 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715 NA 1.00E-06 mr1367 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715 NA 2.73E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715 NA 5.38E-06 mr1374 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715 NA 8.55E-08 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715 NA 8.38E-06 mr1394 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715 NA 1.03E-06 mr1397 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715 NA 1.26E-06 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715 NA 1.06E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715 NA 1.52E-08 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715 NA 2.23E-06 mr1467 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715 NA 2.49E-06 mr1468 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715 NA 9.10E-06 mr1485 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715 NA 1.59E-19 mr1515 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715 NA 7.84E-14 mr1522 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715 NA 6.64E-06 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715 NA 2.30E-08 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715 NA 6.00E-08 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715 NA 4.96E-06 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715 NA 8.79E-13 mr1649 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715 NA 6.09E-09 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715 NA 9.28E-07 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715 1.90E-06 1.91E-06 mr1673 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715 NA 1.07E-06 mr1673 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715 NA 2.50E-11 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715 NA 9.39E-07 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715 NA 7.90E-09 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715 NA 2.04E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715 NA 4.50E-06 mr1976 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715 NA 5.91E-08 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715 NA 3.16E-07 mr1723_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251