Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0332527715:

Variant ID: vg0332527715 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 32527715
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

CTGTTGTCGACTACGAGTCAGATCTTCAGACCGCCATGTCGACAACAGTTAGATAGGCTACCCCACATATTGTACTGGTGTGATTATAGTGAATAAAGAG[C/T]
AATACCGGCTTCGGCCAACAGGATGTAGGGTTATTACCTGACAATTCAGGGGCCCGAACCTGTATAAAAATCCTCGTCCCCATCTCTTTTACCTCAGTCT

Reverse complement sequence

AGACTGAGGTAAAAGAGATGGGGACGAGGATTTTTATACAGGTTCGGGCCCCTGAATTGTCAGGTAATAACCCTACATCCTGTTGGCCGAAGCCGGTATT[G/A]
CTCTTTATTCACTATAATCACACCAGTACAATATGTGGGGTAGCCTATCTAACTGTTGTCGACATGGCGGTCTGAAGATCTGACTCGTAGTCGACAACAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.90%	12.80%	8.78%	3.49%	NA
All Indica	2759	67.50%	14.80%	12.00%	5.76%	NA
All Japonica	1512	99.70%	0.20%	0.07%	0.00%	NA
Aus	269	5.60%	65.40%	27.14%	1.86%	NA
Indica I	595	56.60%	9.70%	23.70%	9.92%	NA
Indica II	465	68.40%	11.60%	13.12%	6.88%	NA
Indica III	913	78.50%	15.40%	3.72%	2.30%	NA
Indica Intermediate	786	62.30%	19.60%	12.09%	5.98%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.20%	0.20%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	90.60%	6.20%	3.12%	0.00%	NA
Intermediate	90	77.80%	13.30%	7.78%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0332527715	C -> T	LOC_Os03g57060.1	upstream_gene_variant ; 1214.0bp to feature; MODIFIER	silent_mutation	Average:28.091; most accessible tissue: Minghui63 root, score: 54.099	N	N	N	N
vg0332527715	C -> T	LOC_Os03g57070.1	upstream_gene_variant ; 4567.0bp to feature; MODIFIER	silent_mutation	Average:28.091; most accessible tissue: Minghui63 root, score: 54.099	N	N	N	N
vg0332527715	C -> T	LOC_Os03g57070.4	upstream_gene_variant ; 4565.0bp to feature; MODIFIER	silent_mutation	Average:28.091; most accessible tissue: Minghui63 root, score: 54.099	N	N	N	N
vg0332527715	C -> T	LOC_Os03g57070.3	upstream_gene_variant ; 4565.0bp to feature; MODIFIER	silent_mutation	Average:28.091; most accessible tissue: Minghui63 root, score: 54.099	N	N	N	N
vg0332527715	C -> T	LOC_Os03g57070.2	upstream_gene_variant ; 4567.0bp to feature; MODIFIER	silent_mutation	Average:28.091; most accessible tissue: Minghui63 root, score: 54.099	N	N	N	N
vg0332527715	C -> T	LOC_Os03g57050.1	downstream_gene_variant ; 2436.0bp to feature; MODIFIER	silent_mutation	Average:28.091; most accessible tissue: Minghui63 root, score: 54.099	N	N	N	N
vg0332527715	C -> T	LOC_Os03g57060-LOC_Os03g57070	intergenic_region ; MODIFIER	silent_mutation	Average:28.091; most accessible tissue: Minghui63 root, score: 54.099	N	N	N	N
vg0332527715	C -> DEL	N	N	silent_mutation	Average:28.091; most accessible tissue: Minghui63 root, score: 54.099	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0332527715	NA	5.38E-07	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715	NA	2.78E-07	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715	NA	1.06E-15	mr1166	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715	NA	1.72E-08	mr1184	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715	NA	9.93E-06	mr1209	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715	NA	3.29E-06	mr1284	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715	NA	4.39E-06	mr1286	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715	NA	2.69E-06	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715	NA	3.22E-06	mr1365	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715	NA	1.00E-06	mr1367	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715	NA	2.73E-07	mr1369	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715	NA	5.38E-06	mr1374	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715	NA	8.55E-08	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715	NA	8.38E-06	mr1394	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715	NA	1.03E-06	mr1397	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715	NA	1.26E-06	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715	NA	1.06E-06	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715	NA	1.52E-08	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715	NA	2.23E-06	mr1467	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715	NA	2.49E-06	mr1468	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715	NA	9.10E-06	mr1485	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715	NA	1.59E-19	mr1515	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715	NA	7.84E-14	mr1522	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715	NA	6.64E-06	mr1545	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715	NA	2.30E-08	mr1556	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715	NA	6.00E-08	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715	NA	4.96E-06	mr1634	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715	NA	8.79E-13	mr1649	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715	NA	6.09E-09	mr1652	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715	NA	9.28E-07	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715	1.90E-06	1.91E-06	mr1673	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715	NA	1.07E-06	mr1673	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715	NA	2.50E-11	mr1730	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715	NA	9.39E-07	mr1762	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715	NA	7.90E-09	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715	NA	2.04E-06	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715	NA	4.50E-06	mr1976	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715	NA	5.91E-08	mr1707_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332527715	NA	3.16E-07	mr1723_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251