\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0331773900:

Variant ID: vg0331773900 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 31773900
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTAGTTGAATTTTTTTCTTTTTCTAATTTCAGAATTTATTTTATTTATTATTATGTTCTTTTGATATTTTTATTTTTTATTTTCAATCGCAGTTGTTTCA[A/T]
AATTGTATTCCTACTTTAACTCTCTTTTTAATTTGCCTAATTTCAGATTATTTATTTATTTATTATTAGAAATTTTAATTAATCTGCTATTGGGTTCTTA

Reverse complement sequence

TAAGAACCCAATAGCAGATTAATTAAAATTTCTAATAATAAATAAATAAATAATCTGAAATTAGGCAAATTAAAAAGAGAGTTAAAGTAGGAATACAATT[T/A]
TGAAACAACTGCGATTGAAAATAAAAAATAAAAATATCAAAAGAACATAATAATAAATAAAATAAATTCTGAAATTAGAAAAAGAAAAAAATTCAACTAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.40% 0.10% 2.05% 0.36% NA
All Indica  2759 95.70% 0.30% 3.48% 0.62% NA
All Japonica  1512 99.90% 0.00% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 93.40% 0.50% 5.38% 0.67% NA
Indica II  465 94.00% 0.00% 5.16% 0.86% NA
Indica III  913 98.00% 0.20% 1.10% 0.66% NA
Indica Intermediate  786 95.50% 0.30% 3.82% 0.38% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0331773900 A -> T LOC_Os03g55810.1 downstream_gene_variant ; 2060.0bp to feature; MODIFIER silent_mutation Average:23.841; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0331773900 A -> T LOC_Os03g55820.1 downstream_gene_variant ; 4371.0bp to feature; MODIFIER silent_mutation Average:23.841; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0331773900 A -> T LOC_Os03g55800-LOC_Os03g55810 intergenic_region ; MODIFIER silent_mutation Average:23.841; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0331773900 A -> DEL N N silent_mutation Average:23.841; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0331773900 4.16E-06 NA mr1027_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251