\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0331359176:

Variant ID: vg0331359176 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 31359176
Reference Allele: TAlternative Allele: C,A
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.59, T: 0.40, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


CAAAATCGTTACGCTCCAACGAACCGTCTAGAACGTCTTCCCAGAAACTACTGCTTCCTCCGTCTCGGATTTTGAGTTTTATTTGCAACGTTTAACCATT[T/C,A]
GTCTTATTTAAAAAAATTTTAATTATTATTTATTTTATTTGTGACTTACTTTTTTATCATTGGTACTTTAAGCACAACTTTTCGTTTTTTATATTTGTAA

Reverse complement sequence

TTACAAATATAAAAAACGAAAAGTTGTGCTTAAAGTACCAATGATAAAAAAGTAAGTCACAAATAAAATAAATAATAATTAAAATTTTTTTAAATAAGAC[A/G,T]
AATGGTTAAACGTTGCAAATAAAACTCAAAATCCGAGACGGAGGAAGCAGTAGTTTCTGGGAAGACGTTCTAGACGGTTCGTTGGAGCGTAACGATTTTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.80% 48.60% 0.25% 0.28% A: 0.02%
All Indica  2759 27.60% 71.70% 0.33% 0.43% NA
All Japonica  1512 99.30% 0.60% 0.07% 0.07% NA
Aus  269 0.70% 98.90% 0.37% 0.00% NA
Indica I  595 10.30% 88.20% 0.50% 1.01% NA
Indica II  465 8.40% 91.00% 0.22% 0.43% NA
Indica III  913 55.10% 44.80% 0.00% 0.11% NA
Indica Intermediate  786 20.10% 78.90% 0.64% 0.38% NA
Temperate Japonica  767 99.30% 0.40% 0.13% 0.13% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 54.40% 43.30% 1.11% 0.00% A: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0331359176 T -> C LOC_Os03g55110.1 downstream_gene_variant ; 969.0bp to feature; MODIFIER silent_mutation Average:89.164; most accessible tissue: Zhenshan97 panicle, score: 98.49 N N N N
vg0331359176 T -> C LOC_Os03g55120.1 downstream_gene_variant ; 179.0bp to feature; MODIFIER silent_mutation Average:89.164; most accessible tissue: Zhenshan97 panicle, score: 98.49 N N N N
vg0331359176 T -> C LOC_Os03g55110-LOC_Os03g55120 intergenic_region ; MODIFIER silent_mutation Average:89.164; most accessible tissue: Zhenshan97 panicle, score: 98.49 N N N N
vg0331359176 T -> A LOC_Os03g55110.1 downstream_gene_variant ; 969.0bp to feature; MODIFIER silent_mutation Average:89.164; most accessible tissue: Zhenshan97 panicle, score: 98.49 N N N N
vg0331359176 T -> A LOC_Os03g55120.1 downstream_gene_variant ; 179.0bp to feature; MODIFIER silent_mutation Average:89.164; most accessible tissue: Zhenshan97 panicle, score: 98.49 N N N N
vg0331359176 T -> A LOC_Os03g55110-LOC_Os03g55120 intergenic_region ; MODIFIER silent_mutation Average:89.164; most accessible tissue: Zhenshan97 panicle, score: 98.49 N N N N
vg0331359176 T -> DEL N N silent_mutation Average:89.164; most accessible tissue: Zhenshan97 panicle, score: 98.49 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0331359176 T A -0.01 0.0 0.0 0.02 0.0 -0.01
vg0331359176 T C 0.02 0.05 0.04 0.02 0.02 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0331359176 NA 9.76E-11 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331359176 NA 4.05E-36 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331359176 NA 3.08E-12 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331359176 NA 3.34E-14 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331359176 NA 3.16E-07 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331359176 NA 6.91E-35 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331359176 NA 5.14E-36 mr1682 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331359176 NA 4.31E-12 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331359176 NA 5.84E-28 mr1723 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331359176 NA 8.43E-11 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331359176 NA 4.42E-21 mr1754 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331359176 NA 8.07E-19 mr1767 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331359176 1.14E-07 1.91E-22 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331359176 2.90E-08 2.70E-10 mr1842 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331359176 NA 1.64E-15 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331359176 NA 1.89E-12 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331359176 NA 9.67E-18 mr1336_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331359176 NA 6.88E-15 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331359176 2.28E-07 1.46E-21 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331359176 6.91E-09 7.21E-10 mr1842_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331359176 1.80E-07 1.01E-26 mr1933_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331359176 2.13E-08 6.52E-08 mr1933_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251