\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0331280409:

Variant ID: vg0331280409 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 31280409
Reference Allele: TAlternative Allele: C,A,TAAGGGTCATA,TG
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.60, C: 0.40, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


ACCCATTTCAACTGTTGATGACAAATCATATGGTTAAAAATTTGAAAGTTTTGAGCCTTAAAAACTGTCGACAGATTACTAGCTAGTTCCATCTTTTATT[T/C,A,TAAGGGTCATA,TG]
CTTACGATTTAAGGTATGATACTCCCTCCGGGCTGATAATACTTGTCGTTTTAGATAAGAGTGATGTCAAACTTTAGAATCTTTGATTATGAATCATTTT

Reverse complement sequence

AAAATGATTCATAATCAAAGATTCTAAAGTTTGACATCACTCTTATCTAAAACGACAAGTATTATCAGCCCGGAGGGAGTATCATACCTTAAATCGTAAG[A/G,T,TATGACCCTTA,CA]
AATAAAAGATGGAACTAGCTAGTAATCTGTCGACAGTTTTTAAGGCTCAAAACTTTCAAATTTTTAACCATATGATTTGTCATCAACAGTTGAAATGGGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.90% 39.00% 2.29% 0.80% A: 0.02%
All Indica  2759 39.90% 55.80% 3.37% 0.87% A: 0.04%
All Japonica  1512 97.90% 0.30% 0.86% 0.93% NA
Aus  269 0.00% 100.00% 0.00% 0.00% NA
Indica I  595 6.40% 84.50% 7.06% 2.02% NA
Indica II  465 40.00% 55.90% 3.23% 0.65% A: 0.22%
Indica III  913 69.90% 29.60% 0.44% 0.11% NA
Indica Intermediate  786 30.40% 64.50% 4.07% 1.02% NA
Temperate Japonica  767 99.60% 0.10% 0.26% 0.00% NA
Tropical Japonica  504 94.60% 0.40% 2.18% 2.78% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 72.20% 25.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0331280409 T -> C LOC_Os03g55010.1 upstream_gene_variant ; 1585.0bp to feature; MODIFIER silent_mutation Average:39.544; most accessible tissue: Minghui63 flower, score: 59.717 N N N N
vg0331280409 T -> C LOC_Os03g55000.1 downstream_gene_variant ; 3373.0bp to feature; MODIFIER silent_mutation Average:39.544; most accessible tissue: Minghui63 flower, score: 59.717 N N N N
vg0331280409 T -> C LOC_Os03g55000-LOC_Os03g55010 intergenic_region ; MODIFIER silent_mutation Average:39.544; most accessible tissue: Minghui63 flower, score: 59.717 N N N N
vg0331280409 T -> TG LOC_Os03g55010.1 upstream_gene_variant ; 1584.0bp to feature; MODIFIER N Average:39.544; most accessible tissue: Minghui63 flower, score: 59.717 N N N N
vg0331280409 T -> TG LOC_Os03g55000.1 downstream_gene_variant ; 3374.0bp to feature; MODIFIER N Average:39.544; most accessible tissue: Minghui63 flower, score: 59.717 N N N N
vg0331280409 T -> TG LOC_Os03g55000-LOC_Os03g55010 intergenic_region ; MODIFIER N Average:39.544; most accessible tissue: Minghui63 flower, score: 59.717 N N N N
vg0331280409 T -> A LOC_Os03g55010.1 upstream_gene_variant ; 1585.0bp to feature; MODIFIER silent_mutation Average:39.544; most accessible tissue: Minghui63 flower, score: 59.717 N N N N
vg0331280409 T -> A LOC_Os03g55000.1 downstream_gene_variant ; 3373.0bp to feature; MODIFIER silent_mutation Average:39.544; most accessible tissue: Minghui63 flower, score: 59.717 N N N N
vg0331280409 T -> A LOC_Os03g55000-LOC_Os03g55010 intergenic_region ; MODIFIER silent_mutation Average:39.544; most accessible tissue: Minghui63 flower, score: 59.717 N N N N
vg0331280409 T -> DEL N N silent_mutation Average:39.544; most accessible tissue: Minghui63 flower, score: 59.717 N N N N
vg0331280409 T -> TAAGGGTCATA LOC_Os03g55010.1 upstream_gene_variant ; 1584.0bp to feature; MODIFIER N Average:39.544; most accessible tissue: Minghui63 flower, score: 59.717 N N N N
vg0331280409 T -> TAAGGGTCATA LOC_Os03g55000.1 downstream_gene_variant ; 3374.0bp to feature; MODIFIER N Average:39.544; most accessible tissue: Minghui63 flower, score: 59.717 N N N N
vg0331280409 T -> TAAGGGTCATA LOC_Os03g55000-LOC_Os03g55010 intergenic_region ; MODIFIER N Average:39.544; most accessible tissue: Minghui63 flower, score: 59.717 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0331280409 NA 6.98E-07 mr1036 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 NA 3.99E-13 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 NA 9.27E-07 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 NA 2.56E-16 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 7.65E-06 NA mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 NA 6.62E-06 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 NA 4.96E-16 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 NA 1.91E-07 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 3.66E-09 2.01E-13 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 6.68E-10 9.47E-14 mr1343 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 5.16E-06 1.39E-09 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 NA 3.22E-23 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 NA 2.88E-14 mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 NA 1.21E-08 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 NA 8.40E-08 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 1.05E-07 NA mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 2.34E-08 9.17E-12 mr1699 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 4.24E-16 4.88E-21 mr1829 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 2.46E-23 9.25E-41 mr1829 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 5.78E-17 3.87E-36 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 4.23E-21 5.54E-34 mr1842 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 9.95E-10 7.02E-27 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 6.38E-10 4.92E-20 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 3.71E-06 NA mr1923 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 9.45E-08 2.15E-20 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 7.48E-08 1.84E-09 mr1933 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 NA 1.44E-07 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 4.89E-06 8.30E-07 mr1036_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 4.88E-07 2.78E-12 mr1036_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 NA 3.90E-12 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 NA 4.85E-08 mr1050_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 NA 4.46E-15 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 3.73E-06 3.17E-11 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 NA 1.06E-06 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 NA 1.76E-08 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 NA 1.49E-22 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 NA 4.59E-13 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 1.25E-10 4.16E-30 mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 2.15E-12 1.78E-16 mr1699_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 NA 1.66E-06 mr1806_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 9.37E-11 1.91E-21 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 3.13E-18 5.47E-41 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 6.19E-11 1.06E-31 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 5.90E-16 9.74E-32 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 4.80E-09 1.38E-30 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 3.82E-13 6.84E-31 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 3.52E-06 6.52E-08 mr1923_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 1.84E-06 6.60E-11 mr1923_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 1.25E-10 7.97E-37 mr1933_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331280409 2.24E-11 2.42E-21 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251