\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0331273085:

Variant ID: vg0331273085 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 31273085
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.64, C: 0.36, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


GCGAAAGAATGTTTCAGTTCACTGCAATATTTGATCCATACATAGTGAAACATTATAAGTACACTAGGTGAAACATTTTTCGGTGGAATAAAAAATAAAA[T/C]
GAATTCCCTTAATAGGGGGTTTTCCAAAATATGTGGGTTTTTTTTGTTGCAATTGAATATTTCAGTTCACTGTAACATTAGATCTATACATAGTGAAACA

Reverse complement sequence

TGTTTCACTATGTATAGATCTAATGTTACAGTGAACTGAAATATTCAATTGCAACAAAAAAAACCCACATATTTTGGAAAACCCCCTATTAAGGGAATTC[A/G]
TTTTATTTTTTATTCCACCGAAAAATGTTTCACCTAGTGTACTTATAATGTTTCACTATGTATGGATCAAATATTGCAGTGAACTGAAACATTCTTTCGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.90% 36.50% 2.79% 0.87% NA
All Indica  2759 41.70% 52.30% 4.53% 1.49% NA
All Japonica  1512 99.70% 0.30% 0.07% 0.00% NA
Aus  269 5.60% 92.90% 1.49% 0.00% NA
Indica I  595 8.70% 81.00% 8.24% 2.02% NA
Indica II  465 41.70% 47.70% 7.74% 2.80% NA
Indica III  913 70.60% 27.50% 1.31% 0.55% NA
Indica Intermediate  786 33.10% 62.00% 3.56% 1.40% NA
Temperate Japonica  767 99.70% 0.10% 0.13% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 76.70% 21.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0331273085 T -> C LOC_Os03g54990.1 upstream_gene_variant ; 3371.0bp to feature; MODIFIER silent_mutation Average:20.645; most accessible tissue: Zhenshan97 flag leaf, score: 27.583 N N N N
vg0331273085 T -> C LOC_Os03g55000.1 upstream_gene_variant ; 3373.0bp to feature; MODIFIER silent_mutation Average:20.645; most accessible tissue: Zhenshan97 flag leaf, score: 27.583 N N N N
vg0331273085 T -> C LOC_Os03g54990-LOC_Os03g55000 intergenic_region ; MODIFIER silent_mutation Average:20.645; most accessible tissue: Zhenshan97 flag leaf, score: 27.583 N N N N
vg0331273085 T -> DEL N N silent_mutation Average:20.645; most accessible tissue: Zhenshan97 flag leaf, score: 27.583 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0331273085 NA 1.27E-06 mr1036 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331273085 NA 6.23E-12 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331273085 NA 4.08E-15 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331273085 NA 4.12E-14 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331273085 6.00E-09 1.14E-13 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331273085 9.00E-11 5.50E-15 mr1343 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331273085 NA 2.47E-08 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331273085 NA 3.78E-23 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331273085 NA 9.08E-09 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331273085 6.46E-06 2.17E-09 mr1699 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331273085 4.00E-14 8.90E-21 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331273085 3.34E-20 1.53E-39 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331273085 1.14E-15 2.66E-35 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331273085 2.32E-20 1.40E-33 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331273085 1.18E-08 3.65E-26 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331273085 1.88E-08 7.57E-19 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331273085 6.65E-07 3.49E-06 mr1923 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331273085 1.61E-08 2.92E-21 mr1933 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331273085 2.36E-09 6.16E-11 mr1933 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331273085 NA 5.48E-07 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331273085 6.49E-06 6.83E-07 mr1036_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331273085 7.39E-07 5.35E-12 mr1036_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331273085 NA 6.86E-11 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331273085 NA 2.45E-07 mr1050_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331273085 1.42E-06 NA mr1169_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331273085 9.43E-07 7.36E-12 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331273085 NA 4.96E-08 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331273085 NA 4.37E-07 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331273085 7.66E-07 NA mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331273085 1.69E-08 1.99E-13 mr1699_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331273085 NA 2.26E-06 mr1806_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331273085 2.40E-11 3.57E-22 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331273085 6.99E-19 3.58E-42 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331273085 4.26E-12 7.34E-33 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331273085 2.54E-18 9.14E-35 mr1842_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331273085 2.06E-09 2.77E-31 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331273085 4.46E-14 1.14E-32 mr1902_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331273085 1.72E-07 1.10E-08 mr1923_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331273085 2.03E-08 1.84E-12 mr1923_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331273085 8.98E-13 2.54E-39 mr1933_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331273085 2.26E-14 3.86E-25 mr1933_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251