Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0331268438:

Variant ID: vg0331268438 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 31268438
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.58, T: 0.43, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


CGTTTCCGGATTTATAAATTATTTAATAAATTATTAATAGAATTTATATTAAATGTTCATTAATTTACAAGAGAAGTTAAATGTGGGAAATAAAATTTCC[G/T]
AAATAAAAGGCATGGTTGGATTTAATTTTTATTAAATTCTCCATGATTAATTATACTCTCTGAAATTTTCTCGGATTTTTCAGAGCTCAATTCCTAATTT

Reverse complement sequence

AAATTAGGAATTGAGCTCTGAAAAATCCGAGAAAATTTCAGAGAGTATAATTAATCATGGAGAATTTAATAAAAATTAAATCCAACCATGCCTTTTATTT[C/A]
GGAAATTTTATTTCCCACATTTAACTTCTCTTGTAAATTAATGAACATTTAATATAAATTCTATTAATAATTTATTAAATAATTTATAAATCCGGAAACG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.60% 41.00% 0.38% 0.04% NA
All Indica  2759 40.00% 59.30% 0.58% 0.07% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 0.40% 99.60% 0.00% 0.00% NA
Indica I  595 6.70% 92.10% 1.18% 0.00% NA
Indica II  465 39.80% 59.40% 0.65% 0.22% NA
Indica III  913 69.80% 30.10% 0.11% 0.00% NA
Indica Intermediate  786 30.80% 68.40% 0.64% 0.13% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 73.30% 24.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0331268438 G -> T LOC_Os03g54990.1 downstream_gene_variant ; 689.0bp to feature; MODIFIER silent_mutation Average:22.939; most accessible tissue: Minghui63 root, score: 38.567 N N N N
vg0331268438 G -> T LOC_Os03g54980-LOC_Os03g54990 intergenic_region ; MODIFIER silent_mutation Average:22.939; most accessible tissue: Minghui63 root, score: 38.567 N N N N
vg0331268438 G -> DEL N N silent_mutation Average:22.939; most accessible tissue: Minghui63 root, score: 38.567 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0331268438 NA 1.01E-07 mr1036 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 NA 6.18E-13 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 NA 1.75E-06 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 NA 3.34E-16 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 1.79E-06 NA mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 NA 1.54E-15 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 NA 3.96E-07 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 9.58E-09 1.59E-13 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 9.66E-10 6.80E-14 mr1343 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 NA 3.44E-09 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 NA 2.23E-23 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 NA 1.07E-13 mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 NA 4.08E-09 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 5.90E-07 NA mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 2.39E-08 7.76E-12 mr1699 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 NA 1.63E-13 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 1.47E-14 9.20E-21 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 1.88E-20 2.22E-38 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 2.32E-14 3.32E-34 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 4.47E-17 3.10E-30 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 2.54E-08 5.51E-26 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 1.25E-07 4.09E-18 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 5.14E-06 NA mr1923 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 6.79E-07 1.39E-19 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 6.34E-07 7.38E-09 mr1933 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 NA 2.99E-07 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 1.86E-07 8.99E-08 mr1036_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 4.37E-08 1.41E-13 mr1036_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 NA 6.12E-12 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 NA 2.77E-08 mr1050_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 NA 5.40E-15 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 3.57E-06 NA mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 9.27E-06 NA mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 2.55E-07 3.95E-06 mr1169_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 2.76E-07 1.14E-12 mr1169_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 NA 2.27E-06 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 5.76E-06 4.84E-09 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 1.02E-06 NA mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 1.03E-08 3.87E-14 mr1699_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 NA 7.65E-08 mr1806_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 1.73E-10 6.60E-22 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 1.51E-15 9.58E-40 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 7.69E-11 5.80E-32 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 2.42E-14 5.85E-31 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 7.09E-09 7.20E-31 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 4.57E-11 1.27E-29 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 7.85E-07 2.03E-08 mr1923_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 5.22E-07 1.03E-11 mr1923_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 1.52E-09 3.99E-36 mr1933_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331268438 3.08E-09 2.47E-20 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251