Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0331248975:

Variant ID: vg0331248975 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 31248975
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTATTAATAGTCTGCGTTTAATATTTATAATTAGTGTCCAAACATCCGATGTGATAGAGACTTAAAAGTTTTAGTCCCATTTAAACAGGGTCTAAGAAAG[G/A]
CATTTGGATAATTGCCAAACCTTAAAGTAGCAAATAGTTAAATTCCCCCTAATTGGAAGTAGTCCCGAGATTCCGCCACTAGCGTTATCAGTTACTACTG

Reverse complement sequence

CAGTAGTAACTGATAACGCTAGTGGCGGAATCTCGGGACTACTTCCAATTAGGGGGAATTTAACTATTTGCTACTTTAAGGTTTGGCAATTATCCAAATG[C/T]
CTTTCTTAGACCCTGTTTAAATGGGACTAAAACTTTTAAGTCTCTATCACATCGGATGTTTGGACACTAATTATAAATATTAAACGCAGACTATTAATAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.10%	41.30%	0.06%	0.49%	NA
All Indica	2759	39.30%	59.90%	0.07%	0.76%	NA
All Japonica	1512	99.50%	0.40%	0.07%	0.07%	NA
Aus	269	0.40%	99.60%	0.00%	0.00%	NA
Indica I	595	6.70%	92.10%	0.00%	1.18%	NA
Indica II	465	40.00%	58.90%	0.00%	1.08%	NA
Indica III	913	68.00%	31.70%	0.11%	0.22%	NA
Indica Intermediate	786	30.20%	68.80%	0.13%	0.89%	NA
Temperate Japonica	767	99.60%	0.30%	0.00%	0.13%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.40%	0.41%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	74.40%	24.40%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0331248975	G -> A	LOC_Os03g54960.1	upstream_gene_variant ; 3240.0bp to feature; MODIFIER	silent_mutation	Average:49.174; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0331248975	G -> A	LOC_Os03g54970.1	downstream_gene_variant ; 1551.0bp to feature; MODIFIER	silent_mutation	Average:49.174; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0331248975	G -> A	LOC_Os03g54970.2	downstream_gene_variant ; 1551.0bp to feature; MODIFIER	silent_mutation	Average:49.174; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0331248975	G -> A	LOC_Os03g54960-LOC_Os03g54970	intergenic_region ; MODIFIER	silent_mutation	Average:49.174; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0331248975	G -> DEL	N	N	silent_mutation	Average:49.174; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0331248975	NA	2.02E-07	mr1036	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	NA	5.96E-11	mr1050	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	NA	1.26E-16	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	NA	5.83E-14	mr1272	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	NA	3.14E-07	mr1272	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	7.94E-10	8.91E-14	mr1343	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	2.12E-11	2.41E-14	mr1343	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	8.24E-06	4.96E-09	mr1354	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	NA	7.70E-14	mr1496	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	2.83E-06	NA	mr1699	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	1.76E-07	1.38E-10	mr1699	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	5.62E-06	5.62E-06	mr1827	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	7.51E-15	8.09E-21	mr1829	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	2.59E-22	1.98E-38	mr1829	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	1.02E-16	6.95E-36	mr1842	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	3.16E-21	1.25E-34	mr1842	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	2.77E-10	1.02E-26	mr1902	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	5.27E-11	2.67E-20	mr1902	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	2.33E-06	4.10E-18	mr1933	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	6.50E-07	1.92E-08	mr1933	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	NA	1.20E-07	mr1979	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	NA	1.15E-06	mr1036_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	6.87E-07	5.75E-12	mr1036_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	NA	6.43E-10	mr1050_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	NA	1.01E-06	mr1050_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	NA	1.26E-15	mr1118_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	5.91E-07	1.89E-11	mr1169_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	NA	5.08E-08	mr1354_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	NA	5.05E-13	mr1496_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	NA	5.85E-07	mr1531_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	8.22E-07	NA	mr1699_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	2.43E-08	9.09E-14	mr1699_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	NA	4.85E-07	mr1806_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	2.52E-09	3.18E-20	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	1.10E-16	7.17E-37	mr1829_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	2.73E-10	2.27E-30	mr1842_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	7.35E-17	8.60E-32	mr1842_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	1.86E-08	2.90E-29	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	4.03E-13	7.82E-30	mr1902_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	NA	2.75E-07	mr1923_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	1.57E-06	1.10E-10	mr1923_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	4.68E-09	1.02E-32	mr1933_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0331248975	5.32E-11	9.98E-20	mr1933_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251