\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0330038160:

Variant ID: vg0330038160 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 30038160
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


GGCAAAGGGCAGCGTCCACATGAAAACAACAGGACGCTACATGACCACAACAACCTGCTTATTAATACCGGAAACTCTAATGCGCGATTGATCGCTACCA[T/C]
GATCGGGTAGCAATCGCCCACCCTCCCCCCTCCCTCCCTCCACGTTTTCTTTTTTTGGCACCGCATTACTTTCCTATTTTAGTAAATTTATACACCTAAA

Reverse complement sequence

TTTAGGTGTATAAATTTACTAAAATAGGAAAGTAATGCGGTGCCAAAAAAAGAAAACGTGGAGGGAGGGAGGGGGGAGGGTGGGCGATTGCTACCCGATC[A/G]
TGGTAGCGATCAATCGCGCATTAGAGTTTCCGGTATTAATAAGCAGGTTGTTGTGGTCATGTAGCGTCCTGTTGTTTTCATGTGGACGCTGCCCTTTGCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.50% 20.80% 0.68% 0.00% NA
All Indica  2759 74.40% 24.50% 1.09% 0.00% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 0.70% 99.30% 0.00% 0.00% NA
Indica I  595 71.90% 28.10% 0.00% 0.00% NA
Indica II  465 81.70% 17.40% 0.86% 0.00% NA
Indica III  913 70.40% 27.70% 1.86% 0.00% NA
Indica Intermediate  786 76.70% 22.10% 1.15% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 88.50% 10.40% 1.04% 0.00% NA
Intermediate  90 71.10% 27.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0330038160 T -> C LOC_Os03g52290.1 upstream_gene_variant ; 4947.0bp to feature; MODIFIER silent_mutation Average:90.064; most accessible tissue: Zhenshan97 flower, score: 96.389 N N N N
vg0330038160 T -> C LOC_Os03g52300.1 upstream_gene_variant ; 1293.0bp to feature; MODIFIER silent_mutation Average:90.064; most accessible tissue: Zhenshan97 flower, score: 96.389 N N N N
vg0330038160 T -> C LOC_Os03g52310.1 downstream_gene_variant ; 889.0bp to feature; MODIFIER silent_mutation Average:90.064; most accessible tissue: Zhenshan97 flower, score: 96.389 N N N N
vg0330038160 T -> C LOC_Os03g52300-LOC_Os03g52310 intergenic_region ; MODIFIER silent_mutation Average:90.064; most accessible tissue: Zhenshan97 flower, score: 96.389 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0330038160 T C -0.08 -0.01 0.0 0.0 -0.07 -0.12

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0330038160 NA 4.37E-08 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330038160 NA 3.96E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330038160 NA 6.26E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330038160 NA 1.81E-08 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330038160 NA 4.79E-07 mr1373 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330038160 NA 1.70E-06 mr1417 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330038160 NA 5.53E-09 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330038160 NA 2.66E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330038160 NA 1.56E-09 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330038160 NA 1.41E-07 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330038160 NA 2.38E-08 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330038160 NA 3.22E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330038160 NA 9.90E-08 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330038160 NA 1.62E-07 mr1677 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330038160 NA 2.16E-06 mr1678 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330038160 NA 8.93E-10 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330038160 NA 6.23E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0330038160 NA 5.59E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251