Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0329590543:

Variant ID: vg0329590543 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 29590543
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:

AGGTGAAGCATCGAAAAGATTCAGAGCAAGTTTTGAAATGTGAAAGCACCACTAGCCGCAGATGATTTTTCAAATCCAAAATTAATCAGAGAATGCTGCT[A/G]
ATTCCTCAACTCGACAATTCCCAAGGTGTTGTCTTGGGATCTACCACATCCACTACACCAAAGTGTGGATACCCATCTGAAACCACCCAGCCTGATTGAC

Reverse complement sequence

GTCAATCAGGCTGGGTGGTTTCAGATGGGTATCCACACTTTGGTGTAGTGGATGTGGTAGATCCCAAGACAACACCTTGGGAATTGTCGAGTTGAGGAAT[T/C]
AGCAGCATTCTCTGATTAATTTTGGATTTGAAAAATCATCTGCGGCTAGTGGTGCTTTCACATTTCAAAACTTGCTCTGAATCTTTTCGATGCTTCACCT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.40%	16.50%	0.06%	0.00%	NA
All Indica	2759	72.20%	27.70%	0.11%	0.00%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	52.90%	47.10%	0.00%	0.00%	NA
Indica III	913	57.60%	42.20%	0.22%	0.00%	NA
Indica Intermediate	786	79.80%	20.10%	0.13%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	86.70%	13.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0329590543	A -> G	LOC_Os03g51680.1	downstream_gene_variant ; 2423.0bp to feature; MODIFIER	silent_mutation	Average:60.549; most accessible tissue: Callus, score: 83.649	N	N	N	N
vg0329590543	A -> G	LOC_Os03g51680.2	downstream_gene_variant ; 2423.0bp to feature; MODIFIER	silent_mutation	Average:60.549; most accessible tissue: Callus, score: 83.649	N	N	N	N
vg0329590543	A -> G	LOC_Os03g51670.1	intron_variant ; MODIFIER	silent_mutation	Average:60.549; most accessible tissue: Callus, score: 83.649	N	N	N	N
vg0329590543	A -> G	LOC_Os03g51670.2	intron_variant ; MODIFIER	silent_mutation	Average:60.549; most accessible tissue: Callus, score: 83.649	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0329590543	NA	3.26E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329590543	NA	3.73E-06	mr1051	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329590543	NA	3.55E-06	mr1130	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329590543	NA	5.83E-07	mr1193	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329590543	NA	7.72E-06	mr1254	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329590543	NA	8.18E-06	mr1432	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329590543	7.45E-06	7.45E-06	mr1470	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329590543	NA	5.40E-09	mr1531	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329590543	NA	2.46E-06	mr1629	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329590543	NA	7.41E-06	mr1668	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329590543	NA	2.58E-06	mr1671	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329590543	NA	3.25E-07	mr1716	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329590543	NA	1.11E-06	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329590543	NA	5.42E-07	mr1928	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329590543	NA	1.56E-06	mr1931	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329590543	NA	4.24E-06	mr1941	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329590543	NA	4.13E-07	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329590543	NA	1.06E-08	mr1958	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329590543	NA	9.21E-08	mr1958	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329590543	NA	3.13E-06	mr1974	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329590543	NA	5.58E-06	mr1976	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329590543	NA	2.00E-06	mr1974_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251