\
| Variant ID: vg0329034942 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 29034942 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 124. )
TTTCATCTATTTGTAAATTGTATTTCTATATAAACTCATATTTCAATATTCTTTAAATTTTAATTTCAAATTTCAATTACTTCTAAATTGTATTTCTATA[T/C]
TGACTTTAAACTCTTCTTCCCATGTTTTTCTTAATTTTGAATTTTAGTTATTTATAAATTGTATTTTTATACGGACTCTGAACTCTACTTCTAATATTCC
GGAATATTAGAAGTAGAGTTCAGAGTCCGTATAAAAATACAATTTATAAATAACTAAAATTCAAAATTAAGAAAAACATGGGAAGAAGAGTTTAAAGTCA[A/G]
TATAGAAATACAATTTAGAAGTAATTGAAATTTGAAATTAAAATTTAAAGAATATTGAAATATGAGTTTATATAGAAATACAATTTACAAATAGATGAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.40% | 17.90% | 0.74% | 0.00% | NA |
| All Indica | 2759 | 69.30% | 29.50% | 1.27% | 0.00% | NA |
| All Japonica | 1512 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 48.60% | 51.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 56.00% | 40.90% | 3.18% | 0.00% | NA |
| Indica Intermediate | 786 | 74.40% | 24.90% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 18.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0329034942 | T -> C | LOC_Os03g50820.1 | downstream_gene_variant ; 3966.0bp to feature; MODIFIER | silent_mutation | Average:20.419; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0329034942 | T -> C | LOC_Os03g50830.1 | downstream_gene_variant ; 2693.0bp to feature; MODIFIER | silent_mutation | Average:20.419; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0329034942 | T -> C | LOC_Os03g50850.1 | downstream_gene_variant ; 4352.0bp to feature; MODIFIER | silent_mutation | Average:20.419; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0329034942 | T -> C | LOC_Os03g50850.2 | downstream_gene_variant ; 4352.0bp to feature; MODIFIER | silent_mutation | Average:20.419; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0329034942 | T -> C | LOC_Os03g50830-LOC_Os03g50850 | intergenic_region ; MODIFIER | silent_mutation | Average:20.419; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0329034942 | NA | 3.40E-07 | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329034942 | NA | 1.78E-06 | mr1060 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329034942 | NA | 3.48E-07 | mr1193 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329034942 | NA | 2.53E-06 | mr1193 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329034942 | NA | 7.73E-06 | mr1280 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329034942 | NA | 7.06E-06 | mr1283 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329034942 | NA | 7.45E-06 | mr1339 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329034942 | NA | 8.33E-06 | mr1375 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329034942 | NA | 1.67E-06 | mr1377 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329034942 | NA | 4.47E-06 | mr1432 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329034942 | NA | 6.18E-06 | mr1439 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329034942 | NA | 6.22E-06 | mr1531 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329034942 | NA | 1.68E-07 | mr1666 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329034942 | NA | 5.03E-06 | mr1928 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329034942 | NA | 3.43E-07 | mr1931 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329034942 | NA | 1.11E-06 | mr1941 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329034942 | NA | 2.33E-09 | mr1958 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329034942 | NA | 7.70E-08 | mr1958 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329034942 | NA | 3.33E-06 | mr1974 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |