\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0329034942:

Variant ID: vg0329034942 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 29034942
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:


TTTCATCTATTTGTAAATTGTATTTCTATATAAACTCATATTTCAATATTCTTTAAATTTTAATTTCAAATTTCAATTACTTCTAAATTGTATTTCTATA[T/C]
TGACTTTAAACTCTTCTTCCCATGTTTTTCTTAATTTTGAATTTTAGTTATTTATAAATTGTATTTTTATACGGACTCTGAACTCTACTTCTAATATTCC

Reverse complement sequence

GGAATATTAGAAGTAGAGTTCAGAGTCCGTATAAAAATACAATTTATAAATAACTAAAATTCAAAATTAAGAAAAACATGGGAAGAAGAGTTTAAAGTCA[A/G]
TATAGAAATACAATTTAGAAGTAATTGAAATTTGAAATTAAAATTTAAAGAATATTGAAATATGAGTTTATATAGAAATACAATTTACAAATAGATGAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.40% 17.90% 0.74% 0.00% NA
All Indica  2759 69.30% 29.50% 1.27% 0.00% NA
All Japonica  1512 99.20% 0.80% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.00% 1.00% 0.00% 0.00% NA
Indica II  465 48.60% 51.20% 0.22% 0.00% NA
Indica III  913 56.00% 40.90% 3.18% 0.00% NA
Indica Intermediate  786 74.40% 24.90% 0.64% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0329034942 T -> C LOC_Os03g50820.1 downstream_gene_variant ; 3966.0bp to feature; MODIFIER silent_mutation Average:20.419; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0329034942 T -> C LOC_Os03g50830.1 downstream_gene_variant ; 2693.0bp to feature; MODIFIER silent_mutation Average:20.419; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0329034942 T -> C LOC_Os03g50850.1 downstream_gene_variant ; 4352.0bp to feature; MODIFIER silent_mutation Average:20.419; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0329034942 T -> C LOC_Os03g50850.2 downstream_gene_variant ; 4352.0bp to feature; MODIFIER silent_mutation Average:20.419; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0329034942 T -> C LOC_Os03g50830-LOC_Os03g50850 intergenic_region ; MODIFIER silent_mutation Average:20.419; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0329034942 NA 3.40E-07 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329034942 NA 1.78E-06 mr1060 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329034942 NA 3.48E-07 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329034942 NA 2.53E-06 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329034942 NA 7.73E-06 mr1280 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329034942 NA 7.06E-06 mr1283 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329034942 NA 7.45E-06 mr1339 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329034942 NA 8.33E-06 mr1375 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329034942 NA 1.67E-06 mr1377 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329034942 NA 4.47E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329034942 NA 6.18E-06 mr1439 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329034942 NA 6.22E-06 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329034942 NA 1.68E-07 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329034942 NA 5.03E-06 mr1928 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329034942 NA 3.43E-07 mr1931 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329034942 NA 1.11E-06 mr1941 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329034942 NA 2.33E-09 mr1958 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329034942 NA 7.70E-08 mr1958 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0329034942 NA 3.33E-06 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251