\
| Variant ID: vg0328947114 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 28947114 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, G: 0.06, others allele: 0.00, population size: 80. )
TTAGCACATGTTTAACCGTTCGTCTTATTTAAAAACTTTTGTGAGATATGTAAAATTATATGCCTACATAAAAATATATTTAACAATGAATCAAATGATA[A/G]
AAAAAGAATTAATAATTACTTAAATTTTTTAAATAAGACGAACAGTCAAACATGTGATAAAAAGTCAACGGCGTCAAACATTTCGAAACTAAGGGAGTAT
ATACTCCCTTAGTTTCGAAATGTTTGACGCCGTTGACTTTTTATCACATGTTTGACTGTTCGTCTTATTTAAAAAATTTAAGTAATTATTAATTCTTTTT[T/C]
TATCATTTGATTCATTGTTAAATATATTTTTATGTAGGCATATAATTTTACATATCTCACAAAAGTTTTTAAATAAGACGAACGGTTAAACATGTGCTAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.40% | 25.50% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 67.40% | 32.30% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 1.90% | 98.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 90.90% | 8.70% | 0.34% | 0.00% | NA |
| Indica II | 465 | 40.60% | 58.70% | 0.65% | 0.00% | NA |
| Indica III | 913 | 65.40% | 34.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 67.80% | 31.90% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 85.40% | 14.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 28.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0328947114 | A -> G | LOC_Os03g50690.1 | upstream_gene_variant ; 2362.0bp to feature; MODIFIER | silent_mutation | Average:50.812; most accessible tissue: Zhenshan97 flower, score: 83.061 | N | N | N | N |
| vg0328947114 | A -> G | LOC_Os03g50690-LOC_Os03g50710 | intergenic_region ; MODIFIER | silent_mutation | Average:50.812; most accessible tissue: Zhenshan97 flower, score: 83.061 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0328947114 | 8.03E-06 | 4.65E-09 | mr1003 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328947114 | NA | 1.35E-06 | mr1006 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328947114 | NA | 1.28E-06 | mr1010 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328947114 | 8.07E-07 | 9.60E-10 | mr1051 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328947114 | NA | 1.37E-06 | mr1052 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328947114 | NA | 6.98E-07 | mr1163 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328947114 | NA | 1.40E-09 | mr1193 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328947114 | 4.28E-06 | 2.04E-08 | mr1536 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328947114 | NA | 2.53E-06 | mr1671 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328947114 | NA | 4.61E-06 | mr1931 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328947114 | NA | 7.37E-06 | mr1974 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328947114 | NA | 1.76E-06 | mr1952_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |