\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0328911258:

Variant ID: vg0328911258 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 28911258
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.52, G: 0.48, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


ATTAGTACGTAATGTTTAGGACAATATTTAAGTAAAACCTTAAAAATATAAATCATGAATAATTCTCAAGTTGTTGAGTTTAAAAATATAAAAATTATAT[A/G]
AATAGATTTGTCTTGAAAAATACTTTCATAAAAGTATACATATATATCACTTTTCAATAAATATTTTTCGTAGAAACAAGAAGTCAAAGTTGTGTTTTGG

Reverse complement sequence

CCAAAACACAACTTTGACTTCTTGTTTCTACGAAAAATATTTATTGAAAAGTGATATATATGTATACTTTTATGAAAGTATTTTTCAAGACAAATCTATT[T/C]
ATATAATTTTTATATTTTTAAACTCAACAACTTGAGAATTATTCATGATTTATATTTTTAAGGTTTTACTTAAATATTGTCCTAAACATTACGTACTAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.00% 17.40% 0.17% 7.45% NA
All Indica  2759 68.00% 28.70% 0.22% 3.01% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 4.10% 0.70% 0.37% 94.80% NA
Indica I  595 91.60% 8.40% 0.00% 0.00% NA
Indica II  465 40.90% 52.00% 0.86% 6.24% NA
Indica III  913 66.50% 31.10% 0.00% 2.41% NA
Indica Intermediate  786 68.10% 27.60% 0.25% 4.07% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 2.10% 0.00% 8.33% NA
Intermediate  90 73.30% 18.90% 1.11% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0328911258 A -> DEL N N silent_mutation Average:35.251; most accessible tissue: Callus, score: 93.372 N N N N
vg0328911258 A -> G LOC_Os03g50630.1 upstream_gene_variant ; 2160.0bp to feature; MODIFIER silent_mutation Average:35.251; most accessible tissue: Callus, score: 93.372 N N N N
vg0328911258 A -> G LOC_Os03g50620.1 downstream_gene_variant ; 4329.0bp to feature; MODIFIER silent_mutation Average:35.251; most accessible tissue: Callus, score: 93.372 N N N N
vg0328911258 A -> G LOC_Os03g50620-LOC_Os03g50630 intergenic_region ; MODIFIER silent_mutation Average:35.251; most accessible tissue: Callus, score: 93.372 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0328911258 9.50E-06 NA mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328911258 2.04E-06 4.63E-08 mr1003 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328911258 7.34E-06 3.94E-06 mr1006 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328911258 NA 5.29E-06 mr1010 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328911258 NA 1.25E-07 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328911258 NA 5.21E-06 mr1030 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328911258 1.76E-06 NA mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328911258 1.32E-07 6.05E-09 mr1051 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328911258 4.54E-06 4.02E-06 mr1052 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328911258 NA 8.53E-06 mr1060 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328911258 NA 7.99E-06 mr1163 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328911258 NA 9.05E-06 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328911258 NA 2.02E-06 mr1241 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328911258 NA 8.93E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328911258 NA 7.20E-06 mr1439 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328911258 1.87E-06 1.87E-06 mr1470 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328911258 6.80E-06 6.80E-06 mr1488 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328911258 NA 8.08E-06 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328911258 8.82E-07 1.58E-08 mr1536 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328911258 NA 7.25E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328911258 NA 2.66E-06 mr1651 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328911258 NA 6.76E-06 mr1657 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328911258 NA 9.57E-06 mr1668 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328911258 NA 8.11E-06 mr1671 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328911258 7.34E-06 NA mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328911258 4.46E-06 4.46E-06 mr1832 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328911258 NA 3.34E-06 mr1928 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328911258 NA 4.47E-09 mr1931 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328911258 NA 1.01E-07 mr1931 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328911258 NA 4.43E-07 mr1958 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328911258 NA 2.74E-06 mr1958 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328911258 NA 5.28E-08 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328911258 NA 3.80E-07 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328911258 NA 7.25E-06 mr1448_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251