\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0328679653:

Variant ID: vg0328679653 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 28679653
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAACTCATAACAAAATAAATTATAATTACGTAAATTTTTTTAATAAGACGAATGGTCAAACATGTGAGAAAAAGTCAACGGCGTTATCTATTAAAAAACG[A/G]
AGGTAGTATTAAATATAGACTACTTACAAAACTAATTACATAAATGAAAACTAATTCGTGAGATAAATTTTTTAAGCCTAATTAATCTATAATTAGAGAA

Reverse complement sequence

TTCTCTAATTATAGATTAATTAGGCTTAAAAAATTTATCTCACGAATTAGTTTTCATTTATGTAATTAGTTTTGTAAGTAGTCTATATTTAATACTACCT[T/C]
CGTTTTTTAATAGATAACGCCGTTGACTTTTTCTCACATGTTTGACCATTCGTCTTATTAAAAAAATTTACGTAATTATAATTTATTTTGTTATGAGTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.20% 7.60% 7.93% 0.23% NA
All Indica  2759 92.00% 1.60% 6.45% 0.00% NA
All Japonica  1512 66.00% 20.60% 12.63% 0.73% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 75.80% 5.40% 18.82% 0.00% NA
Indica II  465 96.80% 0.90% 2.37% 0.00% NA
Indica III  913 99.60% 0.00% 0.44% 0.00% NA
Indica Intermediate  786 92.60% 0.90% 6.49% 0.00% NA
Temperate Japonica  767 41.30% 39.10% 18.12% 1.43% NA
Tropical Japonica  504 94.80% 0.60% 4.56% 0.00% NA
Japonica Intermediate  241 84.20% 3.70% 12.03% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 86.70% 6.70% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0328679653 A -> DEL N N silent_mutation Average:64.211; most accessible tissue: Minghui63 flag leaf, score: 93.28 N N N N
vg0328679653 A -> G LOC_Os03g50300.1 downstream_gene_variant ; 604.0bp to feature; MODIFIER silent_mutation Average:64.211; most accessible tissue: Minghui63 flag leaf, score: 93.28 N N N N
vg0328679653 A -> G LOC_Os03g50300-LOC_Os03g50310 intergenic_region ; MODIFIER silent_mutation Average:64.211; most accessible tissue: Minghui63 flag leaf, score: 93.28 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0328679653 A G 0.01 0.01 0.01 0.01 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0328679653 3.32E-06 NA mr1382 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328679653 NA 1.43E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328679653 NA 1.36E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328679653 NA 8.69E-06 mr1955 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328679653 NA 3.19E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328679653 2.87E-07 NA mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328679653 NA 4.44E-08 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328679653 NA 4.24E-14 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328679653 NA 6.77E-07 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251