\
| Variant ID: vg0328202089 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 28202089 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TAAGTACCTGTGGGGGGCACAACAGAAGGCCTAGCCGAGGAAGGCGGGGTGCTGAACGGTGCACGAAACCCTGAAGCAATCGGCAAGTGAAACGGCTCAC[A/T]
TATATGTGCGAGGCATGTGCAGAAAAATCCTTAAAAATACTTACCTCCGTGCGGAGGGGGAGTCGGCCTAGGAACGTGCGCAGCTGGACGGGGACCAGTC
GACTGGTCCCCGTCCAGCTGCGCACGTTCCTAGGCCGACTCCCCCTCCGCACGGAGGTAAGTATTTTTAAGGATTTTTCTGCACATGCCTCGCACATATA[T/A]
GTGAGCCGTTTCACTTGCCGATTGCTTCAGGGTTTCGTGCACCGTTCAGCACCCCGCCTTCCTCGGCTAGGCCTTCTGTTGTGCCCCCCACAGGTACTTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.60% | 6.00% | 7.34% | 0.00% | NA |
| All Indica | 2759 | 86.80% | 3.30% | 9.89% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 13.80% | 61.00% | 25.28% | 0.00% | NA |
| Indica I | 595 | 58.00% | 5.70% | 36.30% | 0.00% | NA |
| Indica II | 465 | 92.50% | 3.40% | 4.09% | 0.00% | NA |
| Indica III | 913 | 97.00% | 2.50% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 93.50% | 2.20% | 4.33% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 79.20% | 19.80% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 11.10% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0328202089 | A -> T | LOC_Os03g49530.1 | intron_variant ; MODIFIER | silent_mutation | Average:17.617; most accessible tissue: Minghui63 root, score: 29.362 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0328202089 | NA | 2.33E-06 | mr1006 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328202089 | NA | 1.71E-08 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328202089 | NA | 5.02E-07 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328202089 | NA | 4.53E-06 | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328202089 | NA | 6.22E-10 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328202089 | NA | 1.10E-07 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328202089 | NA | 9.03E-06 | mr1433 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328202089 | NA | 3.09E-06 | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328202089 | 1.64E-06 | 1.63E-06 | mr1753 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328202089 | NA | 5.59E-07 | mr1764 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328202089 | NA | 3.43E-07 | mr1810 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328202089 | NA | 1.80E-06 | mr1931 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328202089 | NA | 9.05E-06 | mr1948 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328202089 | NA | 1.61E-06 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328202089 | NA | 2.21E-06 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328202089 | NA | 3.70E-06 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |