\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0328157393:

Variant ID: vg0328157393 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 28157393
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATTATTTGTTAGTTTTATTTCTTAAAATACTTAATTTATCCCTATAACAGGTAGATAATACTTTCTCTGTTTTTTAATAGATGTCGCCGTTGATTTTT[G/A]
AACCCACGTTTAACCATTCGTCTTATTAAAAAAATTTATGTGAATATATAAGATATAAATCATGCTTAAAGTACTTTGAGTAACAAAAATAACTCACAAC

Reverse complement sequence

GTTGTGAGTTATTTTTGTTACTCAAAGTACTTTAAGCATGATTTATATCTTATATATTCACATAAATTTTTTTAATAAGACGAATGGTTAAACGTGGGTT[C/T]
AAAAATCAACGGCGACATCTATTAAAAAACAGAGAAAGTATTATCTACCTGTTATAGGGATAAATTAAGTATTTTAAGAAATAAAACTAACAAATAATTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.20% 4.00% 0.80% 0.00% NA
All Indica  2759 92.00% 6.70% 1.30% 0.00% NA
All Japonica  1512 99.90% 0.00% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 68.40% 25.70% 5.88% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 96.20% 3.70% 0.13% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 4.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0328157393 G -> A LOC_Os03g49480.1 downstream_gene_variant ; 2654.0bp to feature; MODIFIER silent_mutation Average:57.523; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0328157393 G -> A LOC_Os03g49464.2 downstream_gene_variant ; 1963.0bp to feature; MODIFIER silent_mutation Average:57.523; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0328157393 G -> A LOC_Os03g49464.1 intron_variant ; MODIFIER silent_mutation Average:57.523; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0328157393 NA 9.98E-17 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328157393 NA 4.43E-15 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328157393 NA 1.44E-19 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328157393 NA 8.64E-17 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328157393 NA 7.04E-06 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328157393 2.53E-06 1.08E-22 mr1038_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328157393 6.27E-06 3.21E-20 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328157393 NA 6.31E-06 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328157393 1.36E-07 8.03E-23 mr1389_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328157393 1.13E-06 2.66E-21 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251