\
| Variant ID: vg0328157393 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 28157393 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AAATTATTTGTTAGTTTTATTTCTTAAAATACTTAATTTATCCCTATAACAGGTAGATAATACTTTCTCTGTTTTTTAATAGATGTCGCCGTTGATTTTT[G/A]
AACCCACGTTTAACCATTCGTCTTATTAAAAAAATTTATGTGAATATATAAGATATAAATCATGCTTAAAGTACTTTGAGTAACAAAAATAACTCACAAC
GTTGTGAGTTATTTTTGTTACTCAAAGTACTTTAAGCATGATTTATATCTTATATATTCACATAAATTTTTTTAATAAGACGAATGGTTAAACGTGGGTT[C/T]
AAAAATCAACGGCGACATCTATTAAAAAACAGAGAAAGTATTATCTACCTGTTATAGGGATAAATTAAGTATTTTAAGAAATAAAACTAACAAATAATTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.20% | 4.00% | 0.80% | 0.00% | NA |
| All Indica | 2759 | 92.00% | 6.70% | 1.30% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 68.40% | 25.70% | 5.88% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.20% | 3.70% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 4.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0328157393 | G -> A | LOC_Os03g49480.1 | downstream_gene_variant ; 2654.0bp to feature; MODIFIER | silent_mutation | Average:57.523; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0328157393 | G -> A | LOC_Os03g49464.2 | downstream_gene_variant ; 1963.0bp to feature; MODIFIER | silent_mutation | Average:57.523; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0328157393 | G -> A | LOC_Os03g49464.1 | intron_variant ; MODIFIER | silent_mutation | Average:57.523; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0328157393 | NA | 9.98E-17 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328157393 | NA | 4.43E-15 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328157393 | NA | 1.44E-19 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328157393 | NA | 8.64E-17 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328157393 | NA | 7.04E-06 | mr1002_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328157393 | 2.53E-06 | 1.08E-22 | mr1038_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328157393 | 6.27E-06 | 3.21E-20 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328157393 | NA | 6.31E-06 | mr1060_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328157393 | 1.36E-07 | 8.03E-23 | mr1389_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0328157393 | 1.13E-06 | 2.66E-21 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |