\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327963836:

Variant ID: vg0327963836 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 27963836
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATTTTCTACAAGTTTTACAAATTAATGGCTGCTCTATGTTAGTAAATCCTTATATGAATATTTAGAGACTTTTACTACACAGTAAGTATATAATCTTAT[A/T]
TCATAACATGGAAATACATGTTTTGGTGATCCTACAGAACTTAAGTTTACTCAAATTGAAGCTAAATTGTGTTCTACATGAATTTCTAAAGTTTAGCTTA

Reverse complement sequence

TAAGCTAAACTTTAGAAATTCATGTAGAACACAATTTAGCTTCAATTTGAGTAAACTTAAGTTCTGTAGGATCACCAAAACATGTATTTCCATGTTATGA[T/A]
ATAAGATTATATACTTACTGTGTAGTAAAAGTCTCTAAATATTCATATAAGGATTTACTAACATAGAGCAGCCATTAATTTGTAAAACTTGTAGAAAATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.70% 37.00% 6.94% 2.35% NA
All Indica  2759 76.20% 8.70% 11.45% 3.66% NA
All Japonica  1512 4.80% 94.80% 0.26% 0.07% NA
Aus  269 94.10% 1.50% 1.86% 2.60% NA
Indica I  595 77.60% 5.40% 15.29% 1.68% NA
Indica II  465 85.80% 3.40% 7.31% 3.44% NA
Indica III  913 74.30% 11.70% 9.42% 4.60% NA
Indica Intermediate  786 71.60% 10.80% 13.36% 4.20% NA
Temperate Japonica  767 6.00% 93.90% 0.00% 0.13% NA
Tropical Japonica  504 4.00% 95.40% 0.60% 0.00% NA
Japonica Intermediate  241 2.90% 96.70% 0.41% 0.00% NA
VI/Aromatic  96 69.80% 29.20% 0.00% 1.04% NA
Intermediate  90 50.00% 45.60% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0327963836 A -> T LOC_Os03g49090.1 upstream_gene_variant ; 827.0bp to feature; MODIFIER silent_mutation Average:13.443; most accessible tissue: Minghui63 flower, score: 18.795 N N N N
vg0327963836 A -> T LOC_Os03g49080.1 downstream_gene_variant ; 3091.0bp to feature; MODIFIER silent_mutation Average:13.443; most accessible tissue: Minghui63 flower, score: 18.795 N N N N
vg0327963836 A -> T LOC_Os03g49080-LOC_Os03g49090 intergenic_region ; MODIFIER silent_mutation Average:13.443; most accessible tissue: Minghui63 flower, score: 18.795 N N N N
vg0327963836 A -> DEL N N silent_mutation Average:13.443; most accessible tissue: Minghui63 flower, score: 18.795 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0327963836 NA 5.88E-11 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0327963836 1.67E-07 6.19E-11 mr1750 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327963836 NA 2.18E-13 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251