| Variant ID: vg0327963836 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 27963836 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AATTTTCTACAAGTTTTACAAATTAATGGCTGCTCTATGTTAGTAAATCCTTATATGAATATTTAGAGACTTTTACTACACAGTAAGTATATAATCTTAT[A/T]
TCATAACATGGAAATACATGTTTTGGTGATCCTACAGAACTTAAGTTTACTCAAATTGAAGCTAAATTGTGTTCTACATGAATTTCTAAAGTTTAGCTTA
TAAGCTAAACTTTAGAAATTCATGTAGAACACAATTTAGCTTCAATTTGAGTAAACTTAAGTTCTGTAGGATCACCAAAACATGTATTTCCATGTTATGA[T/A]
ATAAGATTATATACTTACTGTGTAGTAAAAGTCTCTAAATATTCATATAAGGATTTACTAACATAGAGCAGCCATTAATTTGTAAAACTTGTAGAAAATT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.70% | 37.00% | 6.94% | 2.35% | NA |
| All Indica | 2759 | 76.20% | 8.70% | 11.45% | 3.66% | NA |
| All Japonica | 1512 | 4.80% | 94.80% | 0.26% | 0.07% | NA |
| Aus | 269 | 94.10% | 1.50% | 1.86% | 2.60% | NA |
| Indica I | 595 | 77.60% | 5.40% | 15.29% | 1.68% | NA |
| Indica II | 465 | 85.80% | 3.40% | 7.31% | 3.44% | NA |
| Indica III | 913 | 74.30% | 11.70% | 9.42% | 4.60% | NA |
| Indica Intermediate | 786 | 71.60% | 10.80% | 13.36% | 4.20% | NA |
| Temperate Japonica | 767 | 6.00% | 93.90% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 4.00% | 95.40% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.90% | 96.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 69.80% | 29.20% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 50.00% | 45.60% | 3.33% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0327963836 | A -> T | LOC_Os03g49090.1 | upstream_gene_variant ; 827.0bp to feature; MODIFIER | silent_mutation | Average:13.443; most accessible tissue: Minghui63 flower, score: 18.795 | N | N | N | N |
| vg0327963836 | A -> T | LOC_Os03g49080.1 | downstream_gene_variant ; 3091.0bp to feature; MODIFIER | silent_mutation | Average:13.443; most accessible tissue: Minghui63 flower, score: 18.795 | N | N | N | N |
| vg0327963836 | A -> T | LOC_Os03g49080-LOC_Os03g49090 | intergenic_region ; MODIFIER | silent_mutation | Average:13.443; most accessible tissue: Minghui63 flower, score: 18.795 | N | N | N | N |
| vg0327963836 | A -> DEL | N | N | silent_mutation | Average:13.443; most accessible tissue: Minghui63 flower, score: 18.795 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0327963836 | NA | 5.88E-11 | Grain_weight | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0327963836 | 1.67E-07 | 6.19E-11 | mr1750 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327963836 | NA | 2.18E-13 | mr1874 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |