\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327950422:

Variant ID: vg0327950422 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 27950422
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


AGAACAAGCTTGCATATGCACAACATCACATTCAATTTGATCATGGTAGGAGCCTATAGAAAAAGGTATTTTAACCAAGCGGGTTACCTTCATCTTACCA[C/T]
ATGTATTAAACCACTGAATATGATAGGGATGTGGATGTGGATGGGTAGTCAAGCCAAGCTTCTTGACCATCTCTTCACTTGCTAAATTGTTGCAACTCCC

Reverse complement sequence

GGGAGTTGCAACAATTTAGCAAGTGAAGAGATGGTCAAGAAGCTTGGCTTGACTACCCATCCACATCCACATCCCTATCATATTCAGTGGTTTAATACAT[G/A]
TGGTAAGATGAAGGTAACCCGCTTGGTTAAAATACCTTTTTCTATAGGCTCCTACCATGATCAAATTGAATGTGATGTTGTGCATATGCAAGCTTGTTCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.00% 40.80% 0.28% 0.00% NA
All Indica  2759 32.00% 67.60% 0.43% 0.00% NA
All Japonica  1512 98.10% 1.90% 0.00% 0.00% NA
Aus  269 95.50% 4.50% 0.00% 0.00% NA
Indica I  595 6.10% 93.80% 0.17% 0.00% NA
Indica II  465 61.50% 37.60% 0.86% 0.00% NA
Indica III  913 30.30% 69.70% 0.00% 0.00% NA
Indica Intermediate  786 36.10% 63.00% 0.89% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 96.00% 4.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 74.40% 24.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0327950422 C -> T LOC_Os03g49050.1 downstream_gene_variant ; 1474.0bp to feature; MODIFIER silent_mutation Average:15.142; most accessible tissue: Minghui63 flag leaf, score: 21.194 N N N N
vg0327950422 C -> T LOC_Os03g49050-LOC_Os03g49070 intergenic_region ; MODIFIER silent_mutation Average:15.142; most accessible tissue: Minghui63 flag leaf, score: 21.194 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0327950422 NA 8.09E-06 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327950422 NA 2.48E-06 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327950422 NA 8.49E-06 mr1297 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327950422 7.78E-06 4.27E-06 mr1306 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327950422 2.44E-06 2.44E-06 mr1419 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327950422 NA 7.09E-06 mr1427 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327950422 NA 2.63E-06 mr1500 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327950422 NA 8.71E-08 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327950422 NA 1.77E-06 mr1511 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327950422 NA 1.01E-12 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327950422 NA 2.77E-06 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327950422 NA 1.58E-06 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327950422 NA 4.68E-06 mr1637 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327950422 NA 9.89E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327950422 NA 9.89E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327950422 NA 1.61E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327950422 NA 6.74E-06 mr1887 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327950422 NA 3.70E-06 mr1942 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251