\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327944341:

Variant ID: vg0327944341 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 27944341
Reference Allele: TAlternative Allele: TCACA,A,TCA,TCACACA,TCACACACACACACACA
Primary Allele: TSecondary Allele: TCACACA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTCAGAAATGGCGAAACACGCCGACGCTTTCATCGCCCTGCCAGGTGAGCTGTTAGCCGACTTGTCAACCCCCCCCCCCCCTCTCTCTCTCTCTCTCTC[T/TCACA,A,TCA,TCACACA,TCACACACACACACACA]
CACACACACACACACATTGACACAATGACACTGATGCAAACACAAACGAGAATTAATTGGCTAATAGTAGTTAGCTAGTAGGGCCTAGGAGTGATCTTAG

Reverse complement sequence

CTAAGATCACTCCTAGGCCCTACTAGCTAACTACTATTAGCCAATTAATTCTCGTTTGTGTTTGCATCAGTGTCATTGTGTCAATGTGTGTGTGTGTGTG[A/TGTGA,T,TGA,TGTGTGA,TGTGTGTGTGTGTGTGA]
GAGAGAGAGAGAGAGAGAGGGGGGGGGGGGGTTGACAAGTCGGCTAACAGCTCACCTGGCAGGGCGATGAAAGCGTCGGCGTGTTTCGCCATTTCTGACT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of TCACACA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.40% 11.60% 3.17% 0.00% TCA: 8.38%; A: 2.29%; TCACA: 1.52%; TCACACACACACACACA: 0.66%
All Indica  2759 62.20% 17.90% 3.19% 0.00% TCA: 12.11%; A: 2.50%; TCACA: 2.07%
All Japonica  1512 89.70% 0.50% 2.78% 0.00% TCA: 3.04%; TCACACACACACACACA: 2.05%; A: 1.79%; TCACA: 0.20%
Aus  269 91.10% 0.40% 2.23% 0.00% TCA: 2.97%; TCACA: 1.86%; A: 1.49%
Indica I  595 50.30% 0.30% 10.92% 0.00% TCA: 34.12%; A: 4.37%
Indica II  465 48.80% 47.70% 1.08% 0.00% TCA: 1.29%; A: 0.86%; TCACA: 0.22%
Indica III  913 71.40% 12.40% 0.99% 0.00% TCA: 7.45%; TCACA: 5.15%; A: 2.63%
Indica Intermediate  786 68.40% 20.10% 1.15% 0.00% TCA: 7.25%; A: 1.91%; TCACA: 1.15%
Temperate Japonica  767 93.20% 0.30% 1.69% 0.00% TCACACACACACACACA: 4.04%; TCA: 0.39%; A: 0.39%
Tropical Japonica  504 81.00% 0.60% 5.56% 0.00% TCA: 7.94%; A: 4.37%; TCACA: 0.60%
Japonica Intermediate  241 96.70% 0.80% 0.41% 0.00% TCA: 1.24%; A: 0.83%
VI/Aromatic  96 47.90% 33.30% 7.29% 0.00% A: 6.25%; TCACA: 5.21%
Intermediate  90 64.40% 14.40% 7.78% 0.00% TCA: 8.89%; TCACA: 2.22%; A: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0327944341 T -> TCACACA LOC_Os03g49040.1 downstream_gene_variant ; 3748.0bp to feature; MODIFIER silent_mutation Average:83.592; most accessible tissue: Zhenshan97 panicle, score: 97.277 N N N N
vg0327944341 T -> TCACACA LOC_Os03g49050.1 intron_variant ; MODIFIER silent_mutation Average:83.592; most accessible tissue: Zhenshan97 panicle, score: 97.277 N N N N
vg0327944341 T -> TCA LOC_Os03g49040.1 downstream_gene_variant ; 3748.0bp to feature; MODIFIER silent_mutation Average:83.592; most accessible tissue: Zhenshan97 panicle, score: 97.277 N N N N
vg0327944341 T -> TCA LOC_Os03g49050.1 intron_variant ; MODIFIER silent_mutation Average:83.592; most accessible tissue: Zhenshan97 panicle, score: 97.277 N N N N
vg0327944341 T -> TCACA LOC_Os03g49040.1 downstream_gene_variant ; 3748.0bp to feature; MODIFIER silent_mutation Average:83.592; most accessible tissue: Zhenshan97 panicle, score: 97.277 N N N N
vg0327944341 T -> TCACA LOC_Os03g49050.1 intron_variant ; MODIFIER silent_mutation Average:83.592; most accessible tissue: Zhenshan97 panicle, score: 97.277 N N N N
vg0327944341 T -> TCACACACACACACACA LOC_Os03g49040.1 downstream_gene_variant ; 3748.0bp to feature; MODIFIER silent_mutation Average:83.592; most accessible tissue: Zhenshan97 panicle, score: 97.277 N N N N
vg0327944341 T -> TCACACACACACACACA LOC_Os03g49050.1 intron_variant ; MODIFIER silent_mutation Average:83.592; most accessible tissue: Zhenshan97 panicle, score: 97.277 N N N N
vg0327944341 T -> A LOC_Os03g49040.1 downstream_gene_variant ; 3747.0bp to feature; MODIFIER silent_mutation Average:83.592; most accessible tissue: Zhenshan97 panicle, score: 97.277 N N N N
vg0327944341 T -> A LOC_Os03g49050.1 intron_variant ; MODIFIER silent_mutation Average:83.592; most accessible tissue: Zhenshan97 panicle, score: 97.277 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0327944341 T A -0.02 -0.02 -0.01 -0.03 -0.03 -0.02
vg0327944341 T TCA 0.23 0.01 0.0 -0.05 0.03 0.08
vg0327944341 T TCACA -0.19 -0.15 -0.04 -0.31 -0.13 -0.01
vg0327944341 T TCACA* 0.37 -0.2 -0.08 -0.06 -0.05 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0327944341 NA 9.64E-06 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327944341 2.84E-06 2.08E-10 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327944341 NA 1.73E-11 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327944341 NA 2.60E-07 mr1224 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327944341 NA 4.25E-06 mr1225 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327944341 NA 2.20E-07 mr1241 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327944341 NA 8.57E-06 mr1287 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327944341 NA 2.21E-06 mr1311 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327944341 NA 9.31E-06 mr1372 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327944341 NA 7.05E-06 mr1398 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327944341 NA 3.00E-06 mr1427 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327944341 NA 9.09E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327944341 NA 6.47E-06 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327944341 NA 2.03E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327944341 NA 3.89E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327944341 NA 2.55E-06 mr1941 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327944341 NA 1.42E-06 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327944341 NA 2.53E-07 mr1193_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251