\
| Variant ID: vg0327937122 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 27937122 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 300. )
TAGTACTAAAAGGACTGAAGAGAAGGGTTTAGGGGAGCAGGAGCAGTCACTTGCTGTTGTGGTTGCTCCGGAACCAACGGTCCCACCGGAAGGTAGTTCC[G/A]
ACAGCGACGTAGGTGACGAAGACGAGGAGTGCTCGTCGCCAAGCGATCCTTGTCCAAGCCCAAGCCCGAAGAGAAGGAAAAAGGGCGACGGTGAAGAAGG
CCTTCTTCACCGTCGCCCTTTTTCCTTCTCTTCGGGCTTGGGCTTGGACAAGGATCGCTTGGCGACGAGCACTCCTCGTCTTCGTCACCTACGTCGCTGT[C/T]
GGAACTACCTTCCGGTGGGACCGTTGGTTCCGGAGCAACCACAACAGCAAGTGACTGCTCCTGCTCCCCTAAACCCTTCTCTTCAGTCCTTTTAGTACTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.80% | 10.10% | 1.12% | 0.00% | NA |
| All Indica | 2759 | 81.50% | 16.60% | 1.88% | 0.00% | NA |
| All Japonica | 1512 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 52.70% | 40.90% | 6.45% | 0.00% | NA |
| Indica III | 913 | 85.50% | 14.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 80.00% | 17.20% | 2.80% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 12.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0327937122 | G -> A | LOC_Os03g49040.1 | missense_variant ; p.Asp37Asn; MODERATE | nonsynonymous_codon ; D37N | Average:27.888; most accessible tissue: Minghui63 panicle, score: 46.754 | benign |
0.091 |
TOLERATED | 0.27 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0327937122 | NA | 6.88E-06 | mr1064 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327937122 | NA | 1.70E-06 | mr1122 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327937122 | NA | 3.93E-07 | mr1193 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327937122 | NA | 2.68E-06 | mr1297 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327937122 | NA | 7.74E-06 | mr1297 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327937122 | NA | 1.72E-06 | mr1432 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327937122 | NA | 9.38E-06 | mr1433 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327937122 | NA | 1.08E-06 | mr1537 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327937122 | NA | 6.50E-07 | mr1821 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327937122 | NA | 4.50E-07 | mr1968 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327937122 | NA | 1.97E-06 | mr1193_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327937122 | NA | 6.00E-06 | mr1720_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |