\
| Variant ID: vg0327700335 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 27700335 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CGAGAAAGCTCGCGTGGCGCAGCGCATGCATGTGTTTTCCTTTTTTTTTTACCATCCATAATCCCTGATCGATTTTGCTATATATTTTTCAACAAATTTT[T/C]
CCCCAAAAATTTGACAGATGTAATTACAGTACAATCGTAGTGTAATTACACTGTAACTTGCATGTAATTACACTGTAACTATAGTGTAACTTGTATGTAA
TTACATACAAGTTACACTATAGTTACAGTGTAATTACATGCAAGTTACAGTGTAATTACACTACGATTGTACTGTAATTACATCTGTCAAATTTTTGGGG[A/G]
AAAATTTGTTGAAAAATATATAGCAAAATCGATCAGGGATTATGGATGGTAAAAAAAAAAGGAAAACACATGCATGCGCTGCGCCACGCGAGCTTTCTCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.50% | 39.60% | 0.87% | 0.00% | NA |
| All Indica | 2759 | 88.60% | 10.30% | 1.16% | 0.00% | NA |
| All Japonica | 1512 | 2.60% | 97.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 95.90% | 1.50% | 2.60% | 0.00% | NA |
| Indica I | 595 | 92.40% | 4.90% | 2.69% | 0.00% | NA |
| Indica II | 465 | 96.60% | 3.00% | 0.43% | 0.00% | NA |
| Indica III | 913 | 83.00% | 16.90% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 87.40% | 10.90% | 1.65% | 0.00% | NA |
| Temperate Japonica | 767 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 6.30% | 93.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.10% | 97.50% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 24.00% | 75.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 52.20% | 47.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0327700335 | T -> C | LOC_Os03g48580.1 | upstream_gene_variant ; 1032.0bp to feature; MODIFIER | silent_mutation | Average:29.334; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg0327700335 | T -> C | LOC_Os03g48590.1 | downstream_gene_variant ; 2788.0bp to feature; MODIFIER | silent_mutation | Average:29.334; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg0327700335 | T -> C | LOC_Os03g48570-LOC_Os03g48580 | intergenic_region ; MODIFIER | silent_mutation | Average:29.334; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0327700335 | NA | 7.83E-06 | mr1064 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327700335 | 5.44E-07 | 1.21E-12 | mr1193 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327700335 | 5.38E-06 | 4.68E-12 | mr1193 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327700335 | NA | 3.63E-06 | mr1928 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327700335 | NA | 9.50E-06 | mr1958 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327700335 | 5.46E-09 | 1.06E-11 | mr1193_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327700335 | 1.08E-08 | 3.22E-12 | mr1193_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |