\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327700335:

Variant ID: vg0327700335 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 27700335
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGAGAAAGCTCGCGTGGCGCAGCGCATGCATGTGTTTTCCTTTTTTTTTTACCATCCATAATCCCTGATCGATTTTGCTATATATTTTTCAACAAATTTT[T/C]
CCCCAAAAATTTGACAGATGTAATTACAGTACAATCGTAGTGTAATTACACTGTAACTTGCATGTAATTACACTGTAACTATAGTGTAACTTGTATGTAA

Reverse complement sequence

TTACATACAAGTTACACTATAGTTACAGTGTAATTACATGCAAGTTACAGTGTAATTACACTACGATTGTACTGTAATTACATCTGTCAAATTTTTGGGG[A/G]
AAAATTTGTTGAAAAATATATAGCAAAATCGATCAGGGATTATGGATGGTAAAAAAAAAAGGAAAACACATGCATGCGCTGCGCCACGCGAGCTTTCTCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.50% 39.60% 0.87% 0.00% NA
All Indica  2759 88.60% 10.30% 1.16% 0.00% NA
All Japonica  1512 2.60% 97.30% 0.07% 0.00% NA
Aus  269 95.90% 1.50% 2.60% 0.00% NA
Indica I  595 92.40% 4.90% 2.69% 0.00% NA
Indica II  465 96.60% 3.00% 0.43% 0.00% NA
Indica III  913 83.00% 16.90% 0.11% 0.00% NA
Indica Intermediate  786 87.40% 10.90% 1.65% 0.00% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 6.30% 93.70% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.50% 0.41% 0.00% NA
VI/Aromatic  96 24.00% 75.00% 1.04% 0.00% NA
Intermediate  90 52.20% 47.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0327700335 T -> C LOC_Os03g48580.1 upstream_gene_variant ; 1032.0bp to feature; MODIFIER silent_mutation Average:29.334; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0327700335 T -> C LOC_Os03g48590.1 downstream_gene_variant ; 2788.0bp to feature; MODIFIER silent_mutation Average:29.334; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0327700335 T -> C LOC_Os03g48570-LOC_Os03g48580 intergenic_region ; MODIFIER silent_mutation Average:29.334; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0327700335 NA 7.83E-06 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327700335 5.44E-07 1.21E-12 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327700335 5.38E-06 4.68E-12 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327700335 NA 3.63E-06 mr1928 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327700335 NA 9.50E-06 mr1958 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327700335 5.46E-09 1.06E-11 mr1193_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327700335 1.08E-08 3.22E-12 mr1193_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251