Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0327700335:

Variant ID: vg0327700335 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 27700335
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGAGAAAGCTCGCGTGGCGCAGCGCATGCATGTGTTTTCCTTTTTTTTTTACCATCCATAATCCCTGATCGATTTTGCTATATATTTTTCAACAAATTTT[T/C]
CCCCAAAAATTTGACAGATGTAATTACAGTACAATCGTAGTGTAATTACACTGTAACTTGCATGTAATTACACTGTAACTATAGTGTAACTTGTATGTAA

Reverse complement sequence

TTACATACAAGTTACACTATAGTTACAGTGTAATTACATGCAAGTTACAGTGTAATTACACTACGATTGTACTGTAATTACATCTGTCAAATTTTTGGGG[A/G]
AAAATTTGTTGAAAAATATATAGCAAAATCGATCAGGGATTATGGATGGTAAAAAAAAAAGGAAAACACATGCATGCGCTGCGCCACGCGAGCTTTCTCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.50%	39.60%	0.87%	0.00%	NA
All Indica	2759	88.60%	10.30%	1.16%	0.00%	NA
All Japonica	1512	2.60%	97.30%	0.07%	0.00%	NA
Aus	269	95.90%	1.50%	2.60%	0.00%	NA
Indica I	595	92.40%	4.90%	2.69%	0.00%	NA
Indica II	465	96.60%	3.00%	0.43%	0.00%	NA
Indica III	913	83.00%	16.90%	0.11%	0.00%	NA
Indica Intermediate	786	87.40%	10.90%	1.65%	0.00%	NA
Temperate Japonica	767	0.40%	99.60%	0.00%	0.00%	NA
Tropical Japonica	504	6.30%	93.70%	0.00%	0.00%	NA
Japonica Intermediate	241	2.10%	97.50%	0.41%	0.00%	NA
VI/Aromatic	96	24.00%	75.00%	1.04%	0.00%	NA
Intermediate	90	52.20%	47.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0327700335	T -> C	LOC_Os03g48580.1	upstream_gene_variant ; 1032.0bp to feature; MODIFIER	silent_mutation	Average:29.334; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0327700335	T -> C	LOC_Os03g48590.1	downstream_gene_variant ; 2788.0bp to feature; MODIFIER	silent_mutation	Average:29.334; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0327700335	T -> C	LOC_Os03g48570-LOC_Os03g48580	intergenic_region ; MODIFIER	silent_mutation	Average:29.334; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0327700335	NA	7.83E-06	mr1064	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327700335	5.44E-07	1.21E-12	mr1193	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327700335	5.38E-06	4.68E-12	mr1193	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327700335	NA	3.63E-06	mr1928	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327700335	NA	9.50E-06	mr1958	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327700335	5.46E-09	1.06E-11	mr1193_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327700335	1.08E-08	3.22E-12	mr1193_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251