\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327690029:

Variant ID: vg0327690029 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 27690029
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.81, A: 0.19, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAAGCTTGAGCCCCGCGAGCTGCTCGAGCTCGACTCATCCATAGCTCAATTCAAGCTCCAGACGACACGAGATGAGCTGAGCCCGACCATATGCCAAA[G/A]
CTCGCAAGTTTTGTTAAGCCGAGCTTAAACTTATAACGAAACTAACAATATATGGTTTTTATTATCTATTTAAAATATTATGAGATTAAATATGTTATTT

Reverse complement sequence

AAATAACATATTTAATCTCATAATATTTTAAATAGATAATAAAAACCATATATTGTTAGTTTCGTTATAAGTTTAAGCTCGGCTTAACAAAACTTGCGAG[C/T]
TTTGGCATATGGTCGGGCTCAGCTCATCTCGTGTCGTCTGGAGCTTGAATTGAGCTATGGATGAGTCGAGCTCGAGCAGCTCGCGGGGCTCAAGCTTTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.30% 37.50% 0.21% 0.04% NA
All Indica  2759 47.50% 52.10% 0.33% 0.07% NA
All Japonica  1512 97.90% 2.10% 0.00% 0.00% NA
Aus  269 1.50% 98.50% 0.00% 0.00% NA
Indica I  595 8.20% 91.30% 0.34% 0.17% NA
Indica II  465 76.60% 22.80% 0.65% 0.00% NA
Indica III  913 58.90% 40.90% 0.11% 0.11% NA
Indica Intermediate  786 46.80% 52.80% 0.38% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 94.40% 5.60% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 86.50% 12.50% 1.04% 0.00% NA
Intermediate  90 71.10% 28.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0327690029 G -> A LOC_Os03g48570.1 upstream_gene_variant ; 1421.0bp to feature; MODIFIER silent_mutation Average:62.23; most accessible tissue: Callus, score: 89.236 N N N N
vg0327690029 G -> A LOC_Os03g48560-LOC_Os03g48570 intergenic_region ; MODIFIER silent_mutation Average:62.23; most accessible tissue: Callus, score: 89.236 N N N N
vg0327690029 G -> DEL N N silent_mutation Average:62.23; most accessible tissue: Callus, score: 89.236 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0327690029 NA 2.65E-11 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327690029 NA 5.02E-09 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327690029 NA 2.33E-13 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327690029 NA 1.21E-12 mr1565 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327690029 NA 1.02E-09 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327690029 NA 1.21E-09 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327690029 NA 9.85E-12 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251