Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0327690029:

Variant ID: vg0327690029 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 27690029
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.81, A: 0.19, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:

AAAAAGCTTGAGCCCCGCGAGCTGCTCGAGCTCGACTCATCCATAGCTCAATTCAAGCTCCAGACGACACGAGATGAGCTGAGCCCGACCATATGCCAAA[G/A]
CTCGCAAGTTTTGTTAAGCCGAGCTTAAACTTATAACGAAACTAACAATATATGGTTTTTATTATCTATTTAAAATATTATGAGATTAAATATGTTATTT

Reverse complement sequence

AAATAACATATTTAATCTCATAATATTTTAAATAGATAATAAAAACCATATATTGTTAGTTTCGTTATAAGTTTAAGCTCGGCTTAACAAAACTTGCGAG[C/T]
TTTGGCATATGGTCGGGCTCAGCTCATCTCGTGTCGTCTGGAGCTTGAATTGAGCTATGGATGAGTCGAGCTCGAGCAGCTCGCGGGGCTCAAGCTTTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.30%	37.50%	0.21%	0.04%	NA
All Indica	2759	47.50%	52.10%	0.33%	0.07%	NA
All Japonica	1512	97.90%	2.10%	0.00%	0.00%	NA
Aus	269	1.50%	98.50%	0.00%	0.00%	NA
Indica I	595	8.20%	91.30%	0.34%	0.17%	NA
Indica II	465	76.60%	22.80%	0.65%	0.00%	NA
Indica III	913	58.90%	40.90%	0.11%	0.11%	NA
Indica Intermediate	786	46.80%	52.80%	0.38%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	94.40%	5.60%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	86.50%	12.50%	1.04%	0.00%	NA
Intermediate	90	71.10%	28.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0327690029	G -> A	LOC_Os03g48570.1	upstream_gene_variant ; 1421.0bp to feature; MODIFIER	silent_mutation	Average:62.23; most accessible tissue: Callus, score: 89.236	N	N	N	N
vg0327690029	G -> A	LOC_Os03g48560-LOC_Os03g48570	intergenic_region ; MODIFIER	silent_mutation	Average:62.23; most accessible tissue: Callus, score: 89.236	N	N	N	N
vg0327690029	G -> DEL	N	N	silent_mutation	Average:62.23; most accessible tissue: Callus, score: 89.236	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0327690029	NA	2.65E-11	mr1272	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327690029	NA	5.02E-09	mr1399	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327690029	NA	2.33E-13	mr1441	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327690029	NA	1.21E-12	mr1565	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327690029	NA	1.02E-09	mr1607	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327690029	NA	1.21E-09	mr1222_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327690029	NA	9.85E-12	mr1565_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251