Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0327580144:

Variant ID: vg0327580144 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 27580144
Reference Allele: C	Alternative Allele: A,T
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.02, A: 0.02, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

AACCCAGAAGCAAGGAGACGGATGGTAAGAAATTCATGTGGCATACTGAGGGTCTGTTTGGTTGGGTATTTCAACTTACCATATTTCAAGTTAGCACATG[C/A,T]
CAAAAGTGTGGCGAACAAAATCCTTGCCATATCTTTGGCTCAAAAATATGTGGCAAAGCAGCAAGAAGCTGTCTAGCTTTCTTTGGCAGACTAAACTATG

Reverse complement sequence

CATAGTTTAGTCTGCCAAAGAAAGCTAGACAGCTTCTTGCTGCTTTGCCACATATTTTTGAGCCAAAGATATGGCAAGGATTTTGTTCGCCACACTTTTG[G/T,A]
CATGTGCTAACTTGAAATATGGTAAGTTGAAATACCCAACCAAACAGACCCTCAGTATGCCACATGAATTTCTTACCATCCGTCTCCTTGCTTCTGGGTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.30%	39.00%	1.67%	5.97%	T: 0.08%
All Indica	2759	22.30%	65.10%	2.54%	10.08%	NA
All Japonica	1512	98.10%	1.30%	0.53%	0.00%	T: 0.07%
Aus	269	97.00%	2.60%	0.00%	0.00%	T: 0.37%
Indica I	595	5.20%	47.10%	7.56%	40.17%	NA
Indica II	465	57.00%	40.60%	1.51%	0.86%	NA
Indica III	913	10.70%	88.50%	0.33%	0.44%	NA
Indica Intermediate	786	28.20%	65.90%	1.91%	3.94%	NA
Temperate Japonica	767	98.00%	1.20%	0.78%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	95.90%	2.90%	0.83%	0.00%	T: 0.41%
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	72.20%	20.00%	1.11%	4.44%	T: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0327580144	C -> T	LOC_Os03g48430.1	downstream_gene_variant ; 765.0bp to feature; MODIFIER	silent_mutation	Average:43.827; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0327580144	C -> T	LOC_Os03g48440.1	downstream_gene_variant ; 3741.0bp to feature; MODIFIER	silent_mutation	Average:43.827; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0327580144	C -> T	LOC_Os03g48410-LOC_Os03g48430	intergenic_region ; MODIFIER	silent_mutation	Average:43.827; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0327580144	C -> A	LOC_Os03g48430.1	downstream_gene_variant ; 765.0bp to feature; MODIFIER	silent_mutation	Average:43.827; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0327580144	C -> A	LOC_Os03g48440.1	downstream_gene_variant ; 3741.0bp to feature; MODIFIER	silent_mutation	Average:43.827; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0327580144	C -> A	LOC_Os03g48410-LOC_Os03g48430	intergenic_region ; MODIFIER	silent_mutation	Average:43.827; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0327580144	C -> DEL	N	N	silent_mutation	Average:43.827; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0327580144	9.97E-10	3.72E-07	mr1193	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327580144	2.05E-09	1.21E-14	mr1193	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327580144	NA	7.69E-06	mr1632	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327580144	NA	4.80E-06	mr1693	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327580144	1.60E-10	NA	mr1193_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327580144	2.19E-10	9.43E-13	mr1193_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327580144	NA	1.32E-13	mr1514_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327580144	NA	1.33E-07	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251