\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327580115:

Variant ID: vg0327580115 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 27580115
Reference Allele: CAAlternative Allele: TA,C
Primary Allele: CASecondary Allele: TA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTGAGGATGGGAAGCATCAGGAGAAAGGAACCCAGAAGCAAGGAGACGGATGGTAAGAAATTCATGTGGCATACTGAGGGTCTGTTTGGTTGGGTATTT[CA/TA,C]
ACTTACCATATTTCAAGTTAGCACATGCCAAAAGTGTGGCGAACAAAATCCTTGCCATATCTTTGGCTCAAAAATATGTGGCAAAGCAGCAAGAAGCTGT

Reverse complement sequence

ACAGCTTCTTGCTGCTTTGCCACATATTTTTGAGCCAAAGATATGGCAAGGATTTTGTTCGCCACACTTTTGGCATGTGCTAACTTGAAATATGGTAAGT[TG/TA,G]
AAATACCCAACCAAACAGACCCTCAGTATGCCACATGAATTTCTTACCATCCGTCTCCTTGCTTCTGGGTTCCTTTCTCCTGATGCTTCCCATCCTCAAG

Allele Frequencies:

Populations Population SizeFrequency of CA(primary allele) Frequency of TA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.50% 10.30% 0.08% 6.03% C: 0.02%
All Indica  2759 72.80% 16.90% 0.14% 10.15% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 59.20% 1.30% 0.50% 38.99% NA
Indica II  465 50.10% 47.70% 0.00% 2.15% NA
Indica III  913 93.00% 6.50% 0.11% 0.44% NA
Indica Intermediate  786 73.00% 22.60% 0.00% 4.33% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 0.00% C: 1.04%
Intermediate  90 82.20% 12.20% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0327580115 CA -> C LOC_Os03g48430.1 downstream_gene_variant ; 793.0bp to feature; MODIFIER silent_mutation Average:40.765; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N
vg0327580115 CA -> C LOC_Os03g48440.1 downstream_gene_variant ; 3769.0bp to feature; MODIFIER silent_mutation Average:40.765; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N
vg0327580115 CA -> C LOC_Os03g48410-LOC_Os03g48430 intergenic_region ; MODIFIER silent_mutation Average:40.765; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N
vg0327580115 CA -> TA LOC_Os03g48430.1 downstream_gene_variant ; 794.0bp to feature; MODIFIER silent_mutation Average:40.765; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N
vg0327580115 CA -> TA LOC_Os03g48440.1 downstream_gene_variant ; 3770.0bp to feature; MODIFIER silent_mutation Average:40.765; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N
vg0327580115 CA -> TA LOC_Os03g48410-LOC_Os03g48430 intergenic_region ; MODIFIER silent_mutation Average:40.765; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N
vg0327580115 CA -> DEL N N silent_mutation Average:40.765; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0327580115 1.14E-09 4.85E-15 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327580115 3.03E-09 1.31E-15 mr1193 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327580115 NA 6.49E-06 mr1693 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327580115 NA 7.58E-07 mr1928 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327580115 NA 4.11E-06 mr1958 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327580115 3.31E-11 2.59E-12 mr1193_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327580115 1.54E-11 5.40E-14 mr1193_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327580115 NA 5.73E-08 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327580115 NA 7.55E-06 mr1659_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251