| Variant ID: vg0327580115 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr03 | Position: 27580115 |
| Reference Allele: CA | Alternative Allele: TA,C |
| Primary Allele: CA | Secondary Allele: TA |
Inferred Ancestral Allele: Not determined.
CTTGAGGATGGGAAGCATCAGGAGAAAGGAACCCAGAAGCAAGGAGACGGATGGTAAGAAATTCATGTGGCATACTGAGGGTCTGTTTGGTTGGGTATTT[CA/TA,C]
ACTTACCATATTTCAAGTTAGCACATGCCAAAAGTGTGGCGAACAAAATCCTTGCCATATCTTTGGCTCAAAAATATGTGGCAAAGCAGCAAGAAGCTGT
ACAGCTTCTTGCTGCTTTGCCACATATTTTTGAGCCAAAGATATGGCAAGGATTTTGTTCGCCACACTTTTGGCATGTGCTAACTTGAAATATGGTAAGT[TG/TA,G]
AAATACCCAACCAAACAGACCCTCAGTATGCCACATGAATTTCTTACCATCCGTCTCCTTGCTTCTGGGTTCCTTTCTCCTGATGCTTCCCATCCTCAAG
| Populations | Population Size | Frequency of CA(primary allele) | Frequency of TA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.50% | 10.30% | 0.08% | 6.03% | C: 0.02% |
| All Indica | 2759 | 72.80% | 16.90% | 0.14% | 10.15% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 59.20% | 1.30% | 0.50% | 38.99% | NA |
| Indica II | 465 | 50.10% | 47.70% | 0.00% | 2.15% | NA |
| Indica III | 913 | 93.00% | 6.50% | 0.11% | 0.44% | NA |
| Indica Intermediate | 786 | 73.00% | 22.60% | 0.00% | 4.33% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 0.00% | C: 1.04% |
| Intermediate | 90 | 82.20% | 12.20% | 0.00% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0327580115 | CA -> C | LOC_Os03g48430.1 | downstream_gene_variant ; 793.0bp to feature; MODIFIER | silent_mutation | Average:40.765; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| vg0327580115 | CA -> C | LOC_Os03g48440.1 | downstream_gene_variant ; 3769.0bp to feature; MODIFIER | silent_mutation | Average:40.765; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| vg0327580115 | CA -> C | LOC_Os03g48410-LOC_Os03g48430 | intergenic_region ; MODIFIER | silent_mutation | Average:40.765; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| vg0327580115 | CA -> TA | LOC_Os03g48430.1 | downstream_gene_variant ; 794.0bp to feature; MODIFIER | silent_mutation | Average:40.765; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| vg0327580115 | CA -> TA | LOC_Os03g48440.1 | downstream_gene_variant ; 3770.0bp to feature; MODIFIER | silent_mutation | Average:40.765; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| vg0327580115 | CA -> TA | LOC_Os03g48410-LOC_Os03g48430 | intergenic_region ; MODIFIER | silent_mutation | Average:40.765; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| vg0327580115 | CA -> DEL | N | N | silent_mutation | Average:40.765; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0327580115 | 1.14E-09 | 4.85E-15 | mr1193 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327580115 | 3.03E-09 | 1.31E-15 | mr1193 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327580115 | NA | 6.49E-06 | mr1693 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327580115 | NA | 7.58E-07 | mr1928 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327580115 | NA | 4.11E-06 | mr1958 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327580115 | 3.31E-11 | 2.59E-12 | mr1193_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327580115 | 1.54E-11 | 5.40E-14 | mr1193_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327580115 | NA | 5.73E-08 | mr1557_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327580115 | NA | 7.55E-06 | mr1659_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |