\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327579635:

Variant ID: vg0327579635 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 27579635
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.79, T: 0.20, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TAACTTTACATGCATGAATGATGTGGCATATCCACGTGGTATTTTAAGTGAGTCAAGGACTATATTAAGCCGCATGATAATCCTTTAGAACTTATTTGGA[C/T]
ATTATAAAATATTAAGGACTAATTCGATCCCTGAGCAAAAGTTGAAGGAGTGAACTGACTATTCACCCTATAATTTTATAAAAGGAGGGAGTAGTAAGAA

Reverse complement sequence

TTCTTACTACTCCCTCCTTTTATAAAATTATAGGGTGAATAGTCAGTTCACTCCTTCAACTTTTGCTCAGGGATCGAATTAGTCCTTAATATTTTATAAT[G/A]
TCCAAATAAGTTCTAAAGGATTATCATGCGGCTTAATATAGTCCTTGACTCACTTAAAATACCACGTGGATATGCCACATCATTCATGCATGTAAAGTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.40% 19.20% 0.55% 5.90% NA
All Indica  2759 68.30% 20.80% 0.91% 9.97% NA
All Japonica  1512 99.20% 0.80% 0.00% 0.00% NA
Aus  269 1.50% 98.10% 0.37% 0.00% NA
Indica I  595 55.30% 1.50% 3.70% 39.50% NA
Indica II  465 44.70% 54.20% 0.22% 0.86% NA
Indica III  913 89.20% 10.30% 0.11% 0.44% NA
Indica Intermediate  786 67.90% 27.90% 0.13% 4.07% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 62.50% 37.50% 0.00% 0.00% NA
Intermediate  90 72.20% 23.30% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0327579635 C -> T LOC_Os03g48430.1 downstream_gene_variant ; 1274.0bp to feature; MODIFIER silent_mutation Average:30.925; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0327579635 C -> T LOC_Os03g48440.1 downstream_gene_variant ; 4250.0bp to feature; MODIFIER silent_mutation Average:30.925; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0327579635 C -> T LOC_Os03g48410-LOC_Os03g48430 intergenic_region ; MODIFIER silent_mutation Average:30.925; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0327579635 C -> DEL N N silent_mutation Average:30.925; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0327579635 2.23E-11 3.57E-21 mr1193 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327579635 8.75E-09 9.39E-15 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327579635 NA 4.75E-13 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327579635 NA 1.75E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327579635 NA 5.56E-06 mr1336 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327579635 NA 2.73E-10 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327579635 NA 8.31E-20 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327579635 NA 6.14E-10 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327579635 NA 8.11E-08 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327579635 5.85E-11 8.33E-26 mr1193_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327579635 5.91E-10 1.86E-12 mr1193_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327579635 NA 1.58E-10 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327579635 NA 7.64E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327579635 NA 1.59E-17 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327579635 NA 2.06E-08 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251