\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327563081:

Variant ID: vg0327563081 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 27563081
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, T: 0.18, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


GACGTAAAAGGACAGACGTGTGGACCAACCAAAGAGGTGAAGCATCTTTTCCCCCTCCCTCAGCTCTCCCCTGTGGCACTGTGAAAGTAGATTAAAACTG[C/T]
CTAAACAGCTTAGAAGAGTTCTCTACACGTACCATCACAGTACTGGGTCTTCTCAATCTGGAAGGAAAGAAGTACTAATTAACAATGTCTACATCACAAC

Reverse complement sequence

GTTGTGATGTAGACATTGTTAATTAGTACTTCTTTCCTTCCAGATTGAGAAGACCCAGTACTGTGATGGTACGTGTAGAGAACTCTTCTAAGCTGTTTAG[G/A]
CAGTTTTAATCTACTTTCACAGTGCCACAGGGGAGAGCTGAGGGAGGGGGAAAAGATGCTTCACCTCTTTGGTTGGTCCACACGTCTGTCCTTTTACGTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.80% 19.00% 0.19% 0.00% NA
All Indica  2759 79.60% 20.20% 0.29% 0.00% NA
All Japonica  1512 99.20% 0.80% 0.00% 0.00% NA
Aus  269 2.20% 97.80% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 44.10% 54.80% 1.08% 0.00% NA
Indica III  913 88.70% 11.20% 0.11% 0.00% NA
Indica Intermediate  786 74.80% 24.90% 0.25% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 50.00% 49.00% 1.04% 0.00% NA
Intermediate  90 75.60% 24.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0327563081 C -> T LOC_Os03g48410.1 downstream_gene_variant ; 4624.0bp to feature; MODIFIER silent_mutation Average:63.436; most accessible tissue: Callus, score: 96.472 N N N N
vg0327563081 C -> T LOC_Os03g48400-LOC_Os03g48410 intergenic_region ; MODIFIER silent_mutation Average:63.436; most accessible tissue: Callus, score: 96.472 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0327563081 2.57E-08 3.64E-19 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327563081 4.48E-07 7.83E-13 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327563081 NA 1.58E-14 mr1232 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327563081 NA 4.93E-07 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327563081 NA 1.59E-23 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327563081 NA 2.31E-08 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327563081 NA 1.99E-06 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327563081 NA 4.61E-06 mr1679 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327563081 NA 3.35E-09 mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327563081 NA 2.34E-09 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327563081 NA 1.55E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327563081 6.61E-09 1.52E-21 mr1193_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327563081 6.72E-09 9.57E-11 mr1193_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327563081 NA 1.54E-10 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327563081 NA 1.82E-18 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327563081 NA 1.45E-09 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251