\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327523224:

Variant ID: vg0327523224 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 27523224
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.65, T: 0.35, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTTTGAATAAGACGAGTGGTCAAATAGTGCAAGCAAAAAGTCAAAATTTATATTATGAGACGGAGGGAGTATTTGGTTCGGTTTCTCTGCCCGTGCGT[T/C]
GATTTTTGTCTCACACTGGAGCTGCTCTTAGGGTGTGTTTAGTTCGTGAAAAGAAATTTTTTTAATAATACATAAATCTCCGTTGGATTTGTTTTGGATG

Reverse complement sequence

CATCCAAAACAAATCCAACGGAGATTTATGTATTATTAAAAAAATTTCTTTTCACGAACTAAACACACCCTAAGAGCAGCTCCAGTGTGAGACAAAAATC[A/G]
ACGCACGGGCAGAGAAACCGAACCAAATACTCCCTCCGTCTCATAATATAAATTTTGACTTTTTGCTTGCACTATTTGACCACTCGTCTTATTCAAAAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.10% 28.80% 0.11% 0.00% NA
All Indica  2759 64.00% 35.80% 0.14% 0.00% NA
All Japonica  1512 99.00% 0.90% 0.07% 0.00% NA
Aus  269 1.90% 98.10% 0.00% 0.00% NA
Indica I  595 49.40% 50.40% 0.17% 0.00% NA
Indica II  465 42.40% 57.20% 0.43% 0.00% NA
Indica III  913 86.10% 13.90% 0.00% 0.00% NA
Indica Intermediate  786 62.20% 37.70% 0.13% 0.00% NA
Temperate Japonica  767 99.50% 0.40% 0.13% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 35.40% 64.60% 0.00% 0.00% NA
Intermediate  90 65.60% 34.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0327523224 T -> C LOC_Os03g48320.1 upstream_gene_variant ; 1732.0bp to feature; MODIFIER silent_mutation Average:49.163; most accessible tissue: Minghui63 root, score: 69.344 N N N N
vg0327523224 T -> C LOC_Os03g48330.1 upstream_gene_variant ; 1399.0bp to feature; MODIFIER silent_mutation Average:49.163; most accessible tissue: Minghui63 root, score: 69.344 N N N N
vg0327523224 T -> C LOC_Os03g48340.1 upstream_gene_variant ; 4734.0bp to feature; MODIFIER silent_mutation Average:49.163; most accessible tissue: Minghui63 root, score: 69.344 N N N N
vg0327523224 T -> C LOC_Os03g48320-LOC_Os03g48330 intergenic_region ; MODIFIER silent_mutation Average:49.163; most accessible tissue: Minghui63 root, score: 69.344 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0327523224 5.95E-08 2.71E-15 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327523224 1.72E-06 6.79E-10 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327523224 NA 1.91E-06 mr1225 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327523224 4.42E-10 7.45E-24 mr1193_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327523224 3.66E-09 1.09E-12 mr1193_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251