\
| Variant ID: vg0327509835 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 27509835 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.04, others allele: 0.00, population size: 209. )
GGGCTGTGTTCAGTTGGCCTTGCAGCCGCTACGGCTGCGGCAGATAGCGCATGCTATTAGGGCCTAGTTTTATAATCTAGATCAATACTTTGAATCTATT[C/T]
TTATTTTCAAATGTAAACAATAAACAACCTCAGGTTAGAAAGCTGAGGTCTAAAAAGAAATTTAGTACCAAGTACTAGTATATTTTTAAAGCTGTTATAA
TTATAACAGCTTTAAAAATATACTAGTACTTGGTACTAAATTTCTTTTTAGACCTCAGCTTTCTAACCTGAGGTTGTTTATTGTTTACATTTGAAAATAA[G/A]
AATAGATTCAAAGTATTGATCTAGATTATAAAACTAGGCCCTAATAGCATGCGCTATCTGCCGCAGCCGTAGCGGCTGCAAGGCCAACTGAACACAGCCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.00% | 19.80% | 0.15% | 0.13% | NA |
| All Indica | 2759 | 68.50% | 31.10% | 0.18% | 0.22% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 50.40% | 49.20% | 0.34% | 0.00% | NA |
| Indica II | 465 | 48.80% | 49.90% | 0.65% | 0.65% | NA |
| Indica III | 913 | 90.30% | 9.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 68.60% | 31.00% | 0.00% | 0.38% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 50.00% | 49.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 20.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0327509835 | C -> T | LOC_Os03g48310.1 | upstream_gene_variant ; 329.0bp to feature; MODIFIER | silent_mutation | Average:54.521; most accessible tissue: Zhenshan97 flower, score: 76.324 | N | N | N | N |
| vg0327509835 | C -> T | LOC_Os03g48300-LOC_Os03g48310 | intergenic_region ; MODIFIER | silent_mutation | Average:54.521; most accessible tissue: Zhenshan97 flower, score: 76.324 | N | N | N | N |
| vg0327509835 | C -> DEL | N | N | silent_mutation | Average:54.521; most accessible tissue: Zhenshan97 flower, score: 76.324 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0327509835 | 1.35E-07 | 1.91E-10 | mr1193 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327509835 | 2.06E-07 | 2.15E-11 | mr1193 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327509835 | NA | 4.65E-06 | mr1224 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327509835 | NA | 1.17E-07 | mr1225 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327509835 | NA | 7.40E-06 | mr1645 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327509835 | NA | 5.10E-07 | mr1063_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327509835 | NA | 6.55E-17 | mr1180_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327509835 | NA | 3.32E-07 | mr1180_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327509835 | 1.25E-06 | NA | mr1193_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327509835 | 3.88E-07 | 3.34E-11 | mr1193_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |