Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0327509835:

Variant ID: vg0327509835 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 27509835
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.04, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:

GGGCTGTGTTCAGTTGGCCTTGCAGCCGCTACGGCTGCGGCAGATAGCGCATGCTATTAGGGCCTAGTTTTATAATCTAGATCAATACTTTGAATCTATT[C/T]
TTATTTTCAAATGTAAACAATAAACAACCTCAGGTTAGAAAGCTGAGGTCTAAAAAGAAATTTAGTACCAAGTACTAGTATATTTTTAAAGCTGTTATAA

Reverse complement sequence

TTATAACAGCTTTAAAAATATACTAGTACTTGGTACTAAATTTCTTTTTAGACCTCAGCTTTCTAACCTGAGGTTGTTTATTGTTTACATTTGAAAATAA[G/A]
AATAGATTCAAAGTATTGATCTAGATTATAAAACTAGGCCCTAATAGCATGCGCTATCTGCCGCAGCCGTAGCGGCTGCAAGGCCAACTGAACACAGCCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.00%	19.80%	0.15%	0.13%	NA
All Indica	2759	68.50%	31.10%	0.18%	0.22%	NA
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	50.40%	49.20%	0.34%	0.00%	NA
Indica II	465	48.80%	49.90%	0.65%	0.65%	NA
Indica III	913	90.30%	9.70%	0.00%	0.00%	NA
Indica Intermediate	786	68.60%	31.00%	0.00%	0.38%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	50.00%	49.00%	1.04%	0.00%	NA
Intermediate	90	78.90%	20.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0327509835	C -> T	LOC_Os03g48310.1	upstream_gene_variant ; 329.0bp to feature; MODIFIER	silent_mutation	Average:54.521; most accessible tissue: Zhenshan97 flower, score: 76.324	N	N	N	N
vg0327509835	C -> T	LOC_Os03g48300-LOC_Os03g48310	intergenic_region ; MODIFIER	silent_mutation	Average:54.521; most accessible tissue: Zhenshan97 flower, score: 76.324	N	N	N	N
vg0327509835	C -> DEL	N	N	silent_mutation	Average:54.521; most accessible tissue: Zhenshan97 flower, score: 76.324	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0327509835	1.35E-07	1.91E-10	mr1193	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327509835	2.06E-07	2.15E-11	mr1193	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327509835	NA	4.65E-06	mr1224	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327509835	NA	1.17E-07	mr1225	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327509835	NA	7.40E-06	mr1645	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327509835	NA	5.10E-07	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327509835	NA	6.55E-17	mr1180_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327509835	NA	3.32E-07	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327509835	1.25E-06	NA	mr1193_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327509835	3.88E-07	3.34E-11	mr1193_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251