\
| Variant ID: vg0327391604 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 27391604 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 232. )
CCAAACCAAACACATGCTTATTATATAAATTGATCAAAACTTGGCACTGAGTCTTTAGGGTGTGTTCACACGAACATGTTCTCAACACAAACAGTAAACA[C/T]
GGAAAACAGAGCGGTCCATTAAAATATGATTAATTAAGTATTTGCTATTTTTTTTAAAAAATAGATAATATGATTTTTTAAGCAACTTTCGTATATAAAC
GTTTATATACGAAAGTTGCTTAAAAAATCATATTATCTATTTTTTAAAAAAAATAGCAAATACTTAATTAATCATATTTTAATGGACCGCTCTGTTTTCC[G/A]
TGTTTACTGTTTGTGTTGAGAACATGTTCGTGTGAACACACCCTAAAGACTCAGTGCCAAGTTTTGATCAATTTATATAATAAGCATGTGTTTGGTTTGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.40% | 11.50% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 95.30% | 4.60% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 91.40% | 8.50% | 0.13% | 0.00% | NA |
| Aus | 269 | 3.30% | 96.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 91.60% | 8.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 95.60% | 4.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 93.60% | 6.10% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 86.20% | 13.60% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 85.40% | 14.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0327391604 | C -> T | LOC_Os03g48140.1 | upstream_gene_variant ; 4374.0bp to feature; MODIFIER | silent_mutation | Average:52.765; most accessible tissue: Zhenshan97 panicle, score: 75.67 | N | N | N | N |
| vg0327391604 | C -> T | LOC_Os03g48150.1 | downstream_gene_variant ; 3436.0bp to feature; MODIFIER | silent_mutation | Average:52.765; most accessible tissue: Zhenshan97 panicle, score: 75.67 | N | N | N | N |
| vg0327391604 | C -> T | LOC_Os03g48140-LOC_Os03g48150 | intergenic_region ; MODIFIER | silent_mutation | Average:52.765; most accessible tissue: Zhenshan97 panicle, score: 75.67 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0327391604 | NA | 3.62E-17 | mr1166 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327391604 | 1.94E-07 | 5.87E-27 | mr1210 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327391604 | 1.44E-06 | 1.17E-08 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327391604 | 1.22E-06 | 3.96E-28 | mr1305 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327391604 | 3.61E-06 | 2.15E-08 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327391604 | NA | 1.64E-06 | mr1320 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327391604 | 1.10E-06 | NA | mr1379 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327391604 | NA | 9.08E-10 | mr1403 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327391604 | NA | 1.53E-14 | mr1409 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327391604 | NA | 1.64E-21 | mr1515 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327391604 | 2.45E-07 | 9.13E-10 | mr1585 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327391604 | 2.69E-06 | 3.70E-09 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327391604 | 2.70E-10 | 7.45E-34 | mr1586 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327391604 | 5.60E-08 | 2.74E-10 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327391604 | NA | 1.17E-15 | mr1649 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327391604 | NA | 1.21E-17 | mr1765 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327391604 | 2.26E-06 | 2.00E-08 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327391604 | NA | 5.71E-22 | mr1305_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327391604 | NA | 9.52E-07 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327391604 | NA | 5.87E-15 | mr1409_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327391604 | 5.65E-06 | NA | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327391604 | NA | 2.12E-07 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327391604 | NA | 1.38E-10 | mr1649_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327391604 | NA | 1.85E-06 | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327391604 | NA | 3.14E-14 | mr1807_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |