\
| Variant ID: vg0327159737 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 27159737 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.07, others allele: 0.00, population size: 200. )
CTTAAGAGGGGAAAGCACTTGAGTGGGGTTAGAGCAAGATCTTGTGCATTCCTGTTCAAATAACTTTGGTACTAGGGTGCAAATGTCAGTTGATTAGAAC[A/G]
AACTTCTTTTTAATTGGAAACTCAAATTTCTAGCCATTGGATCTAGATCCAATCTCTTTTTCTCTCTGCTCCCAATCCATAACTCTCCATGCTCCCCTTC
GAAGGGGAGCATGGAGAGTTATGGATTGGGAGCAGAGAGAAAAAGAGATTGGATCTAGATCCAATGGCTAGAAATTTGAGTTTCCAATTAAAAAGAAGTT[T/C]
GTTCTAATCAACTGACATTTGCACCCTAGTACCAAAGTTATTTGAACAGGAATGCACAAGATCTTGCTCTAACCCCACTCAAGTGCTTTCCCCTCTTAAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.70% | 10.20% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 94.60% | 5.30% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 3.00% | 97.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 91.80% | 8.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 94.40% | 5.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 92.60% | 7.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 45.80% | 54.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 23.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0327159737 | A -> G | LOC_Os03g47820.1 | intron_variant ; MODIFIER | silent_mutation | Average:51.626; most accessible tissue: Callus, score: 72.451 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0327159737 | NA | 1.42E-13 | mr1166 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327159737 | NA | 2.04E-29 | mr1210 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327159737 | NA | 1.91E-13 | mr1231 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327159737 | NA | 6.91E-32 | mr1305 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327159737 | NA | 1.62E-14 | mr1409 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327159737 | NA | 1.35E-06 | mr1415 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327159737 | NA | 1.35E-06 | mr1567 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327159737 | NA | 3.62E-31 | mr1586 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327159737 | NA | 1.33E-11 | mr1649 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327159737 | NA | 1.19E-09 | mr1730 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327159737 | NA | 1.19E-06 | mr1762 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327159737 | NA | 1.47E-16 | mr1765 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327159737 | NA | 9.69E-24 | mr1305_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327159737 | NA | 4.56E-06 | mr1344_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327159737 | NA | 1.78E-12 | mr1409_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327159737 | NA | 8.46E-06 | mr1511_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |