\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327119904:

Variant ID: vg0327119904 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 27119904
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


ACCCCACCCCGGGACCCTAATTCGTCAGCTCTCTACCGAAGTTTGGGTTCGCCGGCGCCGGAGAAGAAAAGGTGGTCGCCGGAGTTGGAGAAGAAGAGCA[C/T]
GAATCGTGAAGCACATCCAGTGATCCAAAAATTGCAAGATTTGAGATTGGATTTTCTGTCGACAGAGACTTAGCAATTCCGTAAAAAATTTCATTTTTCT

Reverse complement sequence

AGAAAAATGAAATTTTTTACGGAATTGCTAAGTCTCTGTCGACAGAAAATCCAATCTCAAATCTTGCAATTTTTGGATCACTGGATGTGCTTCACGATTC[G/A]
TGCTCTTCTTCTCCAACTCCGGCGACCACCTTTTCTTCTCCGGCGCCGGCGAACCCAAACTTCGGTAGAGAGCTGACGAATTAGGGTCCCGGGGTGGGGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.30% 43.50% 0.23% 0.00% NA
All Indica  2759 92.50% 7.30% 0.25% 0.00% NA
All Japonica  1512 1.40% 98.50% 0.07% 0.00% NA
Aus  269 0.70% 98.90% 0.37% 0.00% NA
Indica I  595 91.60% 8.40% 0.00% 0.00% NA
Indica II  465 95.70% 4.30% 0.00% 0.00% NA
Indica III  913 95.00% 4.80% 0.22% 0.00% NA
Indica Intermediate  786 88.30% 11.10% 0.64% 0.00% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 2.00% 97.80% 0.20% 0.00% NA
Japonica Intermediate  241 3.30% 96.70% 0.00% 0.00% NA
VI/Aromatic  96 43.80% 56.20% 0.00% 0.00% NA
Intermediate  90 47.80% 50.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0327119904 C -> T LOC_Os03g47770.1 upstream_gene_variant ; 3372.0bp to feature; MODIFIER silent_mutation Average:83.003; most accessible tissue: Minghui63 root, score: 90.772 N N N N
vg0327119904 C -> T LOC_Os03g47780.1 upstream_gene_variant ; 125.0bp to feature; MODIFIER silent_mutation Average:83.003; most accessible tissue: Minghui63 root, score: 90.772 N N N N
vg0327119904 C -> T LOC_Os03g47780.2 upstream_gene_variant ; 125.0bp to feature; MODIFIER silent_mutation Average:83.003; most accessible tissue: Minghui63 root, score: 90.772 N N N N
vg0327119904 C -> T LOC_Os03g47790.1 downstream_gene_variant ; 4518.0bp to feature; MODIFIER silent_mutation Average:83.003; most accessible tissue: Minghui63 root, score: 90.772 N N N N
vg0327119904 C -> T LOC_Os03g47790.3 downstream_gene_variant ; 4518.0bp to feature; MODIFIER silent_mutation Average:83.003; most accessible tissue: Minghui63 root, score: 90.772 N N N N
vg0327119904 C -> T LOC_Os03g47770-LOC_Os03g47780 intergenic_region ; MODIFIER silent_mutation Average:83.003; most accessible tissue: Minghui63 root, score: 90.772 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0327119904 C T -0.02 -0.01 -0.02 -0.01 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0327119904 NA 4.05E-51 mr1063 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327119904 NA 2.96E-09 mr1260 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327119904 NA 2.46E-14 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327119904 NA 6.95E-10 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327119904 NA 8.00E-32 mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327119904 NA 8.97E-32 mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327119904 NA 3.99E-56 mr1063_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327119904 NA 4.24E-17 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327119904 NA 6.59E-24 mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327119904 NA 3.13E-12 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327119904 NA 4.91E-11 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327119904 NA 1.46E-09 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327119904 NA 1.07E-25 mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327119904 NA 5.15E-43 mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327119904 NA 7.69E-31 mr1580_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327119904 NA 6.27E-11 mr1734_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327119904 NA 1.06E-38 mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327119904 NA 1.23E-08 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327119904 NA 1.30E-53 mr1793_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327119904 NA 7.59E-31 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327119904 NA 6.62E-18 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327119904 NA 2.39E-25 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251