Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0326901219:

Variant ID: vg0326901219 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 26901219
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:

TTGTTCAAAGTCAAGTACCGAGCTGGTCCTAGGCTAGAACGTACTAGAGACGCGAGCCTAGACACAAACGATACCACAAGATAGCACTAGAAACAACTCA[T/A]
GCATGCTCTGATATATAAAAGAAATCTCAATGATACAACTGATTTTCTCTTTTCTTTTTCTTCTTTATTTTTCTTTTTTTTTCTTTTTTTCCTTTCTCTT

Reverse complement sequence

AAGAGAAAGGAAAAAAAGAAAAAAAAAGAAAAATAAAGAAGAAAAAGAAAAGAGAAAATCAGTTGTATCATTGAGATTTCTTTTATATATCAGAGCATGC[A/T]
TGAGTTGTTTCTAGTGCTATCTTGTGGTATCGTTTGTGTCTAGGCTCGCGTCTCTAGTACGTTCTAGCCTAGGACCAGCTCGGTACTTGACTTTGAACAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.70%	17.40%	18.43%	25.56%	NA
All Indica	2759	31.20%	1.20%	30.01%	37.62%	NA
All Japonica	1512	48.10%	50.90%	0.33%	0.66%	NA
Aus	269	38.70%	0.00%	10.78%	50.56%	NA
Indica I	595	24.00%	2.50%	23.70%	49.75%	NA
Indica II	465	35.50%	0.90%	33.33%	30.32%	NA
Indica III	913	32.00%	0.10%	31.87%	36.04%	NA
Indica Intermediate	786	33.20%	1.50%	30.66%	34.61%	NA
Temperate Japonica	767	10.00%	89.60%	0.13%	0.26%	NA
Tropical Japonica	504	97.00%	1.20%	0.60%	1.19%	NA
Japonica Intermediate	241	66.80%	32.00%	0.41%	0.83%	NA
VI/Aromatic	96	89.60%	5.20%	0.00%	5.21%	NA
Intermediate	90	54.40%	14.40%	10.00%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0326901219	T -> A	LOC_Os03g47560.1	upstream_gene_variant ; 4820.0bp to feature; MODIFIER	silent_mutation	Average:12.717; most accessible tissue: Callus, score: 31.83	N	N	N	N
vg0326901219	T -> A	LOC_Os03g47564.1	downstream_gene_variant ; 1693.0bp to feature; MODIFIER	silent_mutation	Average:12.717; most accessible tissue: Callus, score: 31.83	N	N	N	N
vg0326901219	T -> A	LOC_Os03g47574.1	downstream_gene_variant ; 2304.0bp to feature; MODIFIER	silent_mutation	Average:12.717; most accessible tissue: Callus, score: 31.83	N	N	N	N
vg0326901219	T -> A	LOC_Os03g47570.1	intron_variant ; MODIFIER	silent_mutation	Average:12.717; most accessible tissue: Callus, score: 31.83	N	N	N	N
vg0326901219	T -> DEL	N	N	silent_mutation	Average:12.717; most accessible tissue: Callus, score: 31.83	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0326901219	NA	6.11E-12	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0326901219	NA	3.18E-25	mr1115	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219	NA	2.25E-19	mr1115	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219	NA	1.07E-06	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219	NA	1.28E-23	mr1611	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219	NA	3.44E-15	mr1611	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219	NA	9.44E-09	mr1624	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219	NA	3.70E-07	mr1723	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219	NA	1.91E-06	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219	NA	4.02E-16	mr1740	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219	NA	7.11E-06	mr1740	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219	NA	3.26E-12	mr1741	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219	NA	7.49E-24	mr1920	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219	NA	2.33E-13	mr1920	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219	NA	2.03E-06	mr1097_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219	NA	9.50E-28	mr1115_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219	NA	1.24E-17	mr1115_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219	NA	2.33E-06	mr1129_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219	NA	1.04E-32	mr1137_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219	NA	5.19E-08	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219	NA	1.01E-18	mr1156_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219	NA	1.33E-14	mr1241_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219	NA	7.98E-24	mr1611_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219	NA	7.28E-13	mr1611_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219	NA	2.31E-09	mr1624_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219	NA	5.12E-06	mr1693_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219	NA	3.32E-10	mr1741_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219	NA	8.43E-11	mr1844_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251