\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0326901219:

Variant ID: vg0326901219 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 26901219
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


TTGTTCAAAGTCAAGTACCGAGCTGGTCCTAGGCTAGAACGTACTAGAGACGCGAGCCTAGACACAAACGATACCACAAGATAGCACTAGAAACAACTCA[T/A]
GCATGCTCTGATATATAAAAGAAATCTCAATGATACAACTGATTTTCTCTTTTCTTTTTCTTCTTTATTTTTCTTTTTTTTTCTTTTTTTCCTTTCTCTT

Reverse complement sequence

AAGAGAAAGGAAAAAAAGAAAAAAAAAGAAAAATAAAGAAGAAAAAGAAAAGAGAAAATCAGTTGTATCATTGAGATTTCTTTTATATATCAGAGCATGC[A/T]
TGAGTTGTTTCTAGTGCTATCTTGTGGTATCGTTTGTGTCTAGGCTCGCGTCTCTAGTACGTTCTAGCCTAGGACCAGCTCGGTACTTGACTTTGAACAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.70% 17.40% 18.43% 25.56% NA
All Indica  2759 31.20% 1.20% 30.01% 37.62% NA
All Japonica  1512 48.10% 50.90% 0.33% 0.66% NA
Aus  269 38.70% 0.00% 10.78% 50.56% NA
Indica I  595 24.00% 2.50% 23.70% 49.75% NA
Indica II  465 35.50% 0.90% 33.33% 30.32% NA
Indica III  913 32.00% 0.10% 31.87% 36.04% NA
Indica Intermediate  786 33.20% 1.50% 30.66% 34.61% NA
Temperate Japonica  767 10.00% 89.60% 0.13% 0.26% NA
Tropical Japonica  504 97.00% 1.20% 0.60% 1.19% NA
Japonica Intermediate  241 66.80% 32.00% 0.41% 0.83% NA
VI/Aromatic  96 89.60% 5.20% 0.00% 5.21% NA
Intermediate  90 54.40% 14.40% 10.00% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0326901219 T -> A LOC_Os03g47560.1 upstream_gene_variant ; 4820.0bp to feature; MODIFIER silent_mutation Average:12.717; most accessible tissue: Callus, score: 31.83 N N N N
vg0326901219 T -> A LOC_Os03g47564.1 downstream_gene_variant ; 1693.0bp to feature; MODIFIER silent_mutation Average:12.717; most accessible tissue: Callus, score: 31.83 N N N N
vg0326901219 T -> A LOC_Os03g47574.1 downstream_gene_variant ; 2304.0bp to feature; MODIFIER silent_mutation Average:12.717; most accessible tissue: Callus, score: 31.83 N N N N
vg0326901219 T -> A LOC_Os03g47570.1 intron_variant ; MODIFIER silent_mutation Average:12.717; most accessible tissue: Callus, score: 31.83 N N N N
vg0326901219 T -> DEL N N silent_mutation Average:12.717; most accessible tissue: Callus, score: 31.83 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0326901219 NA 6.11E-12 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0326901219 NA 3.18E-25 mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219 NA 2.25E-19 mr1115 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219 NA 1.07E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219 NA 1.28E-23 mr1611 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219 NA 3.44E-15 mr1611 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219 NA 9.44E-09 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219 NA 3.70E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219 NA 1.91E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219 NA 4.02E-16 mr1740 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219 NA 7.11E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219 NA 3.26E-12 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219 NA 7.49E-24 mr1920 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219 NA 2.33E-13 mr1920 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219 NA 2.03E-06 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219 NA 9.50E-28 mr1115_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219 NA 1.24E-17 mr1115_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219 NA 2.33E-06 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219 NA 1.04E-32 mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219 NA 5.19E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219 NA 1.01E-18 mr1156_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219 NA 1.33E-14 mr1241_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219 NA 7.98E-24 mr1611_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219 NA 7.28E-13 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219 NA 2.31E-09 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219 NA 5.12E-06 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219 NA 3.32E-10 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326901219 NA 8.43E-11 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251