\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0326156469:

Variant ID: vg0326156469 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 26156469
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


ACCAAAACAAACCTTACCAAATTTTAGCATTTCCAAATTTTGATTGCGTAACAAATAAATAGAATTGTACCATTGCACTTTTGCCAAATTTTGGTAATTC[C/T]
GGGACCTTCCACTCACATAAACTCCACCATAATTTAGTAAGGTATCAAAGCAAACAACACCATCACATATTTTTATCTTACCAAATATTAGCAATGCCAA

Reverse complement sequence

TTGGCATTGCTAATATTTGGTAAGATAAAAATATGTGATGGTGTTGTTTGCTTTGATACCTTACTAAATTATGGTGGAGTTTATGTGAGTGGAAGGTCCC[G/A]
GAATTACCAAAATTTGGCAAAAGTGCAATGGTACAATTCTATTTATTTGTTACGCAATCAAAATTTGGAAATGCTAAAATTTGGTAAGGTTTGTTTTGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.00% 4.00% 1.04% 0.00% NA
All Indica  2759 91.70% 6.70% 1.63% 0.00% NA
All Japonica  1512 99.80% 0.10% 0.13% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 75.50% 19.20% 5.38% 0.00% NA
Indica II  465 96.60% 2.80% 0.65% 0.00% NA
Indica III  913 99.90% 0.00% 0.11% 0.00% NA
Indica Intermediate  786 91.60% 7.30% 1.15% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 2.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0326156469 C -> T LOC_Os03g46260.1 upstream_gene_variant ; 965.0bp to feature; MODIFIER silent_mutation Average:30.099; most accessible tissue: Callus, score: 56.839 N N N N
vg0326156469 C -> T LOC_Os03g46260.2 upstream_gene_variant ; 965.0bp to feature; MODIFIER silent_mutation Average:30.099; most accessible tissue: Callus, score: 56.839 N N N N
vg0326156469 C -> T LOC_Os03g46260.3 upstream_gene_variant ; 965.0bp to feature; MODIFIER silent_mutation Average:30.099; most accessible tissue: Callus, score: 56.839 N N N N
vg0326156469 C -> T LOC_Os03g46260-LOC_Os03g46270 intergenic_region ; MODIFIER silent_mutation Average:30.099; most accessible tissue: Callus, score: 56.839 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0326156469 NA 6.56E-07 Spikelet_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0326156469 NA 2.39E-08 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326156469 NA 1.92E-07 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326156469 NA 4.92E-06 mr1060_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326156469 NA 1.56E-06 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326156469 7.79E-06 5.62E-08 mr1359_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326156469 3.75E-06 1.70E-08 mr1359_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326156469 NA 1.87E-06 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326156469 NA 2.44E-07 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326156469 NA 4.60E-07 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326156469 NA 7.91E-06 mr1439_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326156469 NA 1.90E-06 mr1520_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326156469 NA 1.97E-06 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326156469 NA 2.68E-07 mr1968_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251