\
| Variant ID: vg0326156469 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 26156469 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 241. )
ACCAAAACAAACCTTACCAAATTTTAGCATTTCCAAATTTTGATTGCGTAACAAATAAATAGAATTGTACCATTGCACTTTTGCCAAATTTTGGTAATTC[C/T]
GGGACCTTCCACTCACATAAACTCCACCATAATTTAGTAAGGTATCAAAGCAAACAACACCATCACATATTTTTATCTTACCAAATATTAGCAATGCCAA
TTGGCATTGCTAATATTTGGTAAGATAAAAATATGTGATGGTGTTGTTTGCTTTGATACCTTACTAAATTATGGTGGAGTTTATGTGAGTGGAAGGTCCC[G/A]
GAATTACCAAAATTTGGCAAAAGTGCAATGGTACAATTCTATTTATTTGTTACGCAATCAAAATTTGGAAATGCTAAAATTTGGTAAGGTTTGTTTTGGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.00% | 4.00% | 1.04% | 0.00% | NA |
| All Indica | 2759 | 91.70% | 6.70% | 1.63% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.10% | 0.13% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 75.50% | 19.20% | 5.38% | 0.00% | NA |
| Indica II | 465 | 96.60% | 2.80% | 0.65% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 91.60% | 7.30% | 1.15% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 2.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0326156469 | C -> T | LOC_Os03g46260.1 | upstream_gene_variant ; 965.0bp to feature; MODIFIER | silent_mutation | Average:30.099; most accessible tissue: Callus, score: 56.839 | N | N | N | N |
| vg0326156469 | C -> T | LOC_Os03g46260.2 | upstream_gene_variant ; 965.0bp to feature; MODIFIER | silent_mutation | Average:30.099; most accessible tissue: Callus, score: 56.839 | N | N | N | N |
| vg0326156469 | C -> T | LOC_Os03g46260.3 | upstream_gene_variant ; 965.0bp to feature; MODIFIER | silent_mutation | Average:30.099; most accessible tissue: Callus, score: 56.839 | N | N | N | N |
| vg0326156469 | C -> T | LOC_Os03g46260-LOC_Os03g46270 | intergenic_region ; MODIFIER | silent_mutation | Average:30.099; most accessible tissue: Callus, score: 56.839 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0326156469 | NA | 6.56E-07 | Spikelet_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0326156469 | NA | 2.39E-08 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326156469 | NA | 1.92E-07 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326156469 | NA | 4.92E-06 | mr1060_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326156469 | NA | 1.56E-06 | mr1060_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326156469 | 7.79E-06 | 5.62E-08 | mr1359_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326156469 | 3.75E-06 | 1.70E-08 | mr1359_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326156469 | NA | 1.87E-06 | mr1378_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326156469 | NA | 2.44E-07 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326156469 | NA | 4.60E-07 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326156469 | NA | 7.91E-06 | mr1439_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326156469 | NA | 1.90E-06 | mr1520_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326156469 | NA | 1.97E-06 | mr1807_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326156469 | NA | 2.68E-07 | mr1968_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |