Variant ID: vg0324945119 (JBrowse) | Variation Type: SNP |
Chromosome: chr03 | Position: 24945119 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.08, others allele: 0.00, population size: 218. )
GAATTCTCTTCTTTGTTAGCTGCCCGTCAACTTCTCCTGGATCGTCTCGTCTAATCTTGTATTGTAGTGCTTTGCAAACAAGGCATGCTTCTAGGTTCTC[A/G]
TACTCCTCACCACGATATAGGATACAATCATTCGGACATGCGTGAATCTTCTGAACTTCCAGTCCTAGAGGGCAAACTATCTTCTTAGCCTCGTACGTTG
CAACGTACGAGGCTAAGAAGATAGTTTGCCCTCTAGGACTGGAAGTTCAGAAGATTCACGCATGTCCGAATGATTGTATCCTATATCGTGGTGAGGAGTA[T/C]
GAGAACCTAGAAGCATGCCTTGTTTGCAAAGCACTACAATACAAGATTAGACGAGACGATCCAGGAGAAGTTGACGGGCAGCTAACAAAGAAGAGAATTC
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 52.90% | 46.80% | 0.25% | 0.04% | NA |
All Indica | 2759 | 80.10% | 19.40% | 0.40% | 0.07% | NA |
All Japonica | 1512 | 0.90% | 99.10% | 0.00% | 0.00% | NA |
Aus | 269 | 83.60% | 16.40% | 0.00% | 0.00% | NA |
Indica I | 595 | 71.40% | 27.70% | 0.84% | 0.00% | NA |
Indica II | 465 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
Indica III | 913 | 84.00% | 15.80% | 0.11% | 0.11% | NA |
Indica Intermediate | 786 | 72.60% | 26.60% | 0.64% | 0.13% | NA |
Temperate Japonica | 767 | 0.70% | 99.30% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 9.40% | 90.60% | 0.00% | 0.00% | NA |
Intermediate | 90 | 45.60% | 53.30% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0324945119 | A -> DEL | LOC_Os03g44370.1 | N | frameshift_variant | Average:27.024; most accessible tissue: Zhenshan97 flower, score: 42.409 | N | N | N | N |
vg0324945119 | A -> G | LOC_Os03g44370.1 | synonymous_variant ; p.Tyr295Tyr; LOW | synonymous_codon | Average:27.024; most accessible tissue: Zhenshan97 flower, score: 42.409 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0324945119 | NA | 7.73E-12 | mr1281 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0324945119 | 6.17E-08 | NA | mr1671 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0324945119 | 2.60E-06 | 1.88E-10 | mr1671 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0324945119 | NA | 4.44E-06 | mr1733 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0324945119 | NA | 3.77E-06 | mr1821 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0324945119 | NA | 4.33E-07 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0324945119 | 1.21E-06 | NA | mr1031_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0324945119 | NA | 9.38E-07 | mr1212_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0324945119 | NA | 1.51E-06 | mr1671_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |