\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0324882835:

Variant ID: vg0324882835 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 24882835
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACCCCGCCGTGCAGGCCCGGCGCCAGGCTCGCCGCGCCCGTGCTCCTGGGACTCCCCCACCTCAAGACGCTCTCCCTCTTCGGCTGCTTCGTCGTCGCC[G/T]
ACTGTTAGAAATTAATCTTGTTGTTTCTTAATTTCAGCATGTTTATCTATATGCATGTGTGTATTGCATGGCCTGGAGAGCTAGCTATATGTACGTGGGT

Reverse complement sequence

ACCCACGTACATATAGCTAGCTCTCCAGGCCATGCAATACACACATGCATATAGATAAACATGCTGAAATTAAGAAACAACAAGATTAATTTCTAACAGT[C/A]
GGCGACGACGAAGCAGCCGAAGAGGGAGAGCGTCTTGAGGTGGGGGAGTCCCAGGAGCACGGGCGCGGCGAGCCTGGCGCCGGGCCTGCACGGCGGGGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.00% 4.90% 2.05% 0.00% NA
All Indica  2759 96.80% 1.20% 1.99% 0.00% NA
All Japonica  1512 88.30% 9.30% 2.45% 0.00% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 94.10% 0.00% 5.88% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 97.80% 1.10% 1.10% 0.00% NA
Indica Intermediate  786 95.70% 3.10% 1.27% 0.00% NA
Temperate Japonica  767 96.90% 0.30% 2.87% 0.00% NA
Tropical Japonica  504 71.40% 26.40% 2.18% 0.00% NA
Japonica Intermediate  241 96.30% 2.10% 1.66% 0.00% NA
VI/Aromatic  96 53.10% 43.80% 3.12% 0.00% NA
Intermediate  90 85.60% 12.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0324882835 G -> T LOC_Os03g44260.1 missense_variant ; p.Asp84Tyr; MODERATE nonsynonymous_codon ; D84F Average:81.817; most accessible tissue: Zhenshan97 flower, score: 91.451 unknown unknown DELETERIOUS 0.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0324882835 G T 0.0 0.01 0.02 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0324882835 5.07E-07 NA mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324882835 4.32E-06 2.36E-09 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324882835 NA 1.13E-09 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324882835 7.82E-06 NA mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324882835 9.73E-06 6.43E-10 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324882835 NA 1.93E-07 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324882835 NA 4.27E-06 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324882835 1.33E-07 3.56E-08 mr1408 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324882835 5.99E-07 2.54E-09 mr1408 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324882835 NA 5.75E-06 mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324882835 2.68E-06 NA mr1522 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324882835 7.10E-06 NA mr1560 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324882835 NA 9.74E-07 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324882835 NA 6.80E-08 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324882835 NA 3.52E-06 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324882835 NA 9.91E-07 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324882835 NA 1.45E-06 mr1646_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324882835 8.65E-06 2.32E-07 mr1929_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324882835 NA 1.87E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251