Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0324638889:

Variant ID: vg0324638889 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 24638889
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 331. )

Flanking Sequence (100 bp) in Reference Genome:

TACTAGCAAAGTCATTAGACACCTCCGCAAAGCATTGTTCAGAGTACTCGTTAAAATGTGTGAGAACTGCATTGCTATCTTGCAACCGTCCCAGTCTGCC[A/G]
GAGTAAACACAAAAAAAAAGTAGGGGTTTCCATTAGCAGCAAAAGACAAGGAACACAGCAATTCCTGCAAATTCTACTGCTAAAGTATAGAAAACTGTAT

Reverse complement sequence

ATACAGTTTTCTATACTTTAGCAGTAGAATTTGCAGGAATTGCTGTGTTCCTTGTCTTTTGCTGCTAATGGAAACCCCTACTTTTTTTTTGTGTTTACTC[T/C]
GGCAGACTGGGACGGTTGCAAGATAGCAATGCAGTTCTCACACATTTTAACGAGTACTCTGAACAATGCTTTGCGGAGGTGTCTAATGACTTTGCTAGTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.90%	8.30%	3.41%	0.34%	NA
All Indica	2759	99.10%	0.10%	0.72%	0.00%	NA
All Japonica	1512	64.40%	25.50%	9.06%	1.06%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.00%	0.30%	1.68%	0.00%	NA
Indica II	465	99.80%	0.00%	0.22%	0.00%	NA
Indica III	913	99.80%	0.00%	0.22%	0.00%	NA
Indica Intermediate	786	98.90%	0.30%	0.89%	0.00%	NA
Temperate Japonica	767	37.00%	47.60%	13.43%	1.96%	NA
Tropical Japonica	504	96.80%	0.80%	2.38%	0.00%	NA
Japonica Intermediate	241	83.80%	6.60%	9.13%	0.41%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	91.10%	5.60%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0324638889	A -> DEL	N	N	silent_mutation	Average:47.577; most accessible tissue: Minghui63 flower, score: 67.065	N	N	N	N
vg0324638889	A -> G	LOC_Os03g43910.1	splice_region_variant&intron_variant ; LOW	silent_mutation	Average:47.577; most accessible tissue: Minghui63 flower, score: 67.065	N	N	N	N
vg0324638889	A -> G	LOC_Os03g43900.1	upstream_gene_variant ; 4106.0bp to feature; MODIFIER	silent_mutation	Average:47.577; most accessible tissue: Minghui63 flower, score: 67.065	N	N	N	N
vg0324638889	A -> G	LOC_Os03g43920.1	upstream_gene_variant ; 4377.0bp to feature; MODIFIER	silent_mutation	Average:47.577; most accessible tissue: Minghui63 flower, score: 67.065	N	N	N	N
vg0324638889	A -> G	LOC_Os03g43900.2	upstream_gene_variant ; 4106.0bp to feature; MODIFIER	silent_mutation	Average:47.577; most accessible tissue: Minghui63 flower, score: 67.065	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0324638889	NA	1.56E-11	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0324638889	NA	1.21E-06	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324638889	NA	3.32E-06	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324638889	NA	4.86E-07	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324638889	NA	6.76E-09	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324638889	NA	4.39E-08	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324638889	NA	7.40E-12	mr1486_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324638889	1.43E-06	NA	mr1530_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324638889	NA	1.02E-11	mr1530_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324638889	NA	1.98E-07	mr1588_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324638889	NA	1.13E-06	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324638889	NA	1.02E-10	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324638889	NA	6.89E-08	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324638889	NA	1.25E-06	mr1768_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324638889	NA	2.36E-06	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251