\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0324638889:

Variant ID: vg0324638889 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 24638889
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 331. )

Flanking Sequence (100 bp) in Reference Genome:


TACTAGCAAAGTCATTAGACACCTCCGCAAAGCATTGTTCAGAGTACTCGTTAAAATGTGTGAGAACTGCATTGCTATCTTGCAACCGTCCCAGTCTGCC[A/G]
GAGTAAACACAAAAAAAAAGTAGGGGTTTCCATTAGCAGCAAAAGACAAGGAACACAGCAATTCCTGCAAATTCTACTGCTAAAGTATAGAAAACTGTAT

Reverse complement sequence

ATACAGTTTTCTATACTTTAGCAGTAGAATTTGCAGGAATTGCTGTGTTCCTTGTCTTTTGCTGCTAATGGAAACCCCTACTTTTTTTTTGTGTTTACTC[T/C]
GGCAGACTGGGACGGTTGCAAGATAGCAATGCAGTTCTCACACATTTTAACGAGTACTCTGAACAATGCTTTGCGGAGGTGTCTAATGACTTTGCTAGTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.90% 8.30% 3.41% 0.34% NA
All Indica  2759 99.10% 0.10% 0.72% 0.00% NA
All Japonica  1512 64.40% 25.50% 9.06% 1.06% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.00% 0.30% 1.68% 0.00% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 99.80% 0.00% 0.22% 0.00% NA
Indica Intermediate  786 98.90% 0.30% 0.89% 0.00% NA
Temperate Japonica  767 37.00% 47.60% 13.43% 1.96% NA
Tropical Japonica  504 96.80% 0.80% 2.38% 0.00% NA
Japonica Intermediate  241 83.80% 6.60% 9.13% 0.41% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 91.10% 5.60% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0324638889 A -> DEL N N silent_mutation Average:47.577; most accessible tissue: Minghui63 flower, score: 67.065 N N N N
vg0324638889 A -> G LOC_Os03g43910.1 splice_region_variant&intron_variant ; LOW silent_mutation Average:47.577; most accessible tissue: Minghui63 flower, score: 67.065 N N N N
vg0324638889 A -> G LOC_Os03g43900.1 upstream_gene_variant ; 4106.0bp to feature; MODIFIER silent_mutation Average:47.577; most accessible tissue: Minghui63 flower, score: 67.065 N N N N
vg0324638889 A -> G LOC_Os03g43920.1 upstream_gene_variant ; 4377.0bp to feature; MODIFIER silent_mutation Average:47.577; most accessible tissue: Minghui63 flower, score: 67.065 N N N N
vg0324638889 A -> G LOC_Os03g43900.2 upstream_gene_variant ; 4106.0bp to feature; MODIFIER silent_mutation Average:47.577; most accessible tissue: Minghui63 flower, score: 67.065 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0324638889 NA 1.56E-11 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0324638889 NA 1.21E-06 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324638889 NA 3.32E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324638889 NA 4.86E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324638889 NA 6.76E-09 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324638889 NA 4.39E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324638889 NA 7.40E-12 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324638889 1.43E-06 NA mr1530_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324638889 NA 1.02E-11 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324638889 NA 1.98E-07 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324638889 NA 1.13E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324638889 NA 1.02E-10 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324638889 NA 6.89E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324638889 NA 1.25E-06 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324638889 NA 2.36E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251